Incidental Mutation 'R1241:Dennd5b'
ID 151994
Institutional Source Beutler Lab
Gene Symbol Dennd5b
Ensembl Gene ENSMUSG00000030313
Gene Name DENN domain containing 5B
Synonyms D030011O10Rik, 9330160C06Rik
MMRRC Submission 039308-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.148) question?
Stock # R1241 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 148889569-149003178 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 148969988 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 155 (M155T)
Ref Sequence ENSEMBL: ENSMUSP00000107182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111557] [ENSMUST00000127727] [ENSMUST00000145555]
AlphaFold A2RSQ0
Predicted Effect probably benign
Transcript: ENSMUST00000111557
AA Change: M155T

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000107182
Gene: ENSMUSG00000030313
AA Change: M155T

DomainStartEndE-ValueType
uDENN 18 120 9.96e-39 SMART
low complexity region 145 161 N/A INTRINSIC
DENN 187 375 2.97e-78 SMART
dDENN 498 574 5.92e-23 SMART
RUN 866 929 2.13e-22 SMART
Pfam:PLAT 938 1043 1.7e-12 PFAM
low complexity region 1070 1081 N/A INTRINSIC
RUN 1205 1265 8.42e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121283
Predicted Effect probably benign
Transcript: ENSMUST00000127727
SMART Domains Protein: ENSMUSP00000123568
Gene: ENSMUSG00000030313

DomainStartEndE-ValueType
uDENN 18 142 5.45e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145555
SMART Domains Protein: ENSMUSP00000127731
Gene: ENSMUSG00000030313

DomainStartEndE-ValueType
uDENN 1 42 3.03e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150436
Meta Mutation Damage Score 0.0754 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency 100% (61/61)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit normal blood lymphocyte populations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 183,765,702 (GRCm39) S119N probably benign Het
9030619P08Rik A C 15: 75,301,846 (GRCm39) noncoding transcript Het
Aldh1l2 T C 10: 83,331,889 (GRCm39) I639V probably benign Het
Ambra1 T C 2: 91,601,241 (GRCm39) probably benign Het
Ap5z1 T C 5: 142,455,869 (GRCm39) Y299H probably damaging Het
Atp6v1b1 A T 6: 83,733,526 (GRCm39) probably benign Het
Atr G A 9: 95,832,689 (GRCm39) V2574I probably benign Het
Atxn1l T A 8: 110,459,612 (GRCm39) T217S probably benign Het
Ccdc85a A G 11: 28,346,150 (GRCm39) S89P probably benign Het
Ccn5 T A 2: 163,670,997 (GRCm39) M168K unknown Het
Cd209e A T 8: 3,899,124 (GRCm39) I196N probably damaging Het
Cdhr4 A G 9: 107,872,495 (GRCm39) S247G probably benign Het
Cntn6 A T 6: 104,809,470 (GRCm39) I502F probably damaging Het
Crisp4 T C 1: 18,193,018 (GRCm39) Y233C probably damaging Het
Ctsb C A 14: 63,376,553 (GRCm39) T261N probably benign Het
Ctsk T C 3: 95,408,185 (GRCm39) F14L probably benign Het
Dchs1 T C 7: 105,407,385 (GRCm39) I2110V probably damaging Het
Echdc3 T C 2: 6,217,611 (GRCm39) D54G probably benign Het
Egln3 G A 12: 54,228,479 (GRCm39) T209I probably damaging Het
Fbn1 A C 2: 125,214,447 (GRCm39) probably benign Het
Fkbp15 A T 4: 62,222,846 (GRCm39) S1018T possibly damaging Het
Flnb T C 14: 7,896,503 (GRCm38) I898T probably benign Het
Flt1 T A 5: 147,536,456 (GRCm39) Y795F probably damaging Het
Flt4 C T 11: 49,527,166 (GRCm39) probably benign Het
Fryl T C 5: 73,267,614 (GRCm39) E417G probably damaging Het
Fryl A G 5: 73,222,268 (GRCm39) probably benign Het
Gcnt3 T C 9: 69,941,615 (GRCm39) I318V probably benign Het
Gm11437 T A 11: 84,055,454 (GRCm39) H54L possibly damaging Het
Huwe1 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA X: 150,690,044 (GRCm39) probably benign Het
Jarid2 G A 13: 45,038,368 (GRCm39) probably benign Het
Kif5b A T 18: 6,214,044 (GRCm39) V653E probably benign Het
Kmt2b A G 7: 30,274,365 (GRCm39) V2113A probably damaging Het
Knl1 C T 2: 118,903,054 (GRCm39) T1585I probably benign Het
Mlxipl T A 5: 135,161,572 (GRCm39) M497K probably benign Het
Mre11a T A 9: 14,710,935 (GRCm39) W210R probably damaging Het
Mrps22 A G 9: 98,476,748 (GRCm39) V207A probably benign Het
Myo15a A G 11: 60,390,256 (GRCm39) I2111V possibly damaging Het
Myo1a C T 10: 127,555,148 (GRCm39) P838L probably benign Het
Nbea T A 3: 55,965,461 (GRCm39) H484L probably damaging Het
Nfix G A 8: 85,453,155 (GRCm39) R300C probably damaging Het
Nlrp2 T A 7: 5,331,430 (GRCm39) D322V probably damaging Het
Nrcam T C 12: 44,636,947 (GRCm39) C1057R probably damaging Het
Ntsr1 T C 2: 180,142,394 (GRCm39) S62P probably damaging Het
Nudt18 A G 14: 70,816,867 (GRCm39) H157R probably benign Het
Or10s1 C A 9: 39,986,192 (GRCm39) N200K probably damaging Het
Or5g25 T A 2: 85,477,904 (GRCm39) T254S probably damaging Het
Sidt2 T C 9: 45,857,002 (GRCm39) T435A probably damaging Het
Snx27 T C 3: 94,427,540 (GRCm39) T312A probably benign Het
Srebf2 T C 15: 82,061,720 (GRCm39) S429P probably damaging Het
Suclg2 A G 6: 95,474,563 (GRCm39) probably benign Het
Tchh A T 3: 93,352,279 (GRCm39) E573V unknown Het
Tdrd1 A G 19: 56,850,192 (GRCm39) T985A probably benign Het
Ttc7b A G 12: 100,369,698 (GRCm39) I357T possibly damaging Het
Ttn T C 2: 76,626,008 (GRCm39) E13271G probably damaging Het
Usp13 A G 3: 32,969,857 (GRCm39) E661G probably damaging Het
Vasp T G 7: 18,992,958 (GRCm39) probably benign Het
Vmn2r109 A T 17: 20,775,503 (GRCm39) Y75N possibly damaging Het
Vmn2r15 T A 5: 109,440,770 (GRCm39) N363Y probably damaging Het
Vmn2r60 T A 7: 41,786,476 (GRCm39) N426K probably benign Het
Znhit2 C A 19: 6,112,288 (GRCm39) N344K probably damaging Het
Other mutations in Dennd5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Dennd5b APN 6 148,928,828 (GRCm39) missense probably damaging 1.00
IGL00590:Dennd5b APN 6 148,969,806 (GRCm39) missense probably benign 0.03
IGL00727:Dennd5b APN 6 148,908,214 (GRCm39) splice site probably benign
IGL00838:Dennd5b APN 6 148,906,861 (GRCm39) splice site probably benign
IGL01115:Dennd5b APN 6 148,911,246 (GRCm39) splice site probably benign
IGL01150:Dennd5b APN 6 148,969,583 (GRCm39) missense probably benign 0.01
IGL01873:Dennd5b APN 6 148,946,027 (GRCm39) missense probably benign
IGL01991:Dennd5b APN 6 148,982,322 (GRCm39) missense probably damaging 1.00
IGL02226:Dennd5b APN 6 148,934,799 (GRCm39) missense probably benign 0.00
IGL02820:Dennd5b APN 6 148,920,840 (GRCm39) missense probably null 0.51
IGL03056:Dennd5b APN 6 148,956,570 (GRCm39) missense probably damaging 1.00
IGL03085:Dennd5b APN 6 148,928,893 (GRCm39) missense probably damaging 1.00
IGL03329:Dennd5b APN 6 148,899,758 (GRCm39) missense possibly damaging 0.53
R0081:Dennd5b UTSW 6 148,895,257 (GRCm39) missense probably benign 0.13
R0617:Dennd5b UTSW 6 148,934,760 (GRCm39) splice site probably benign
R1252:Dennd5b UTSW 6 148,945,985 (GRCm39) missense probably damaging 1.00
R1255:Dennd5b UTSW 6 148,943,148 (GRCm39) missense possibly damaging 0.48
R1641:Dennd5b UTSW 6 148,969,703 (GRCm39) missense probably damaging 1.00
R1674:Dennd5b UTSW 6 148,899,782 (GRCm39) missense probably damaging 1.00
R1781:Dennd5b UTSW 6 148,928,896 (GRCm39) missense probably damaging 1.00
R1861:Dennd5b UTSW 6 148,969,760 (GRCm39) missense probably damaging 1.00
R1907:Dennd5b UTSW 6 148,943,074 (GRCm39) missense probably benign 0.00
R2412:Dennd5b UTSW 6 148,906,736 (GRCm39) missense possibly damaging 0.88
R3794:Dennd5b UTSW 6 149,002,715 (GRCm39) missense possibly damaging 0.87
R3825:Dennd5b UTSW 6 148,946,334 (GRCm39) missense probably benign
R4581:Dennd5b UTSW 6 148,918,482 (GRCm39) splice site silent
R4654:Dennd5b UTSW 6 148,908,335 (GRCm39) missense probably damaging 1.00
R4725:Dennd5b UTSW 6 148,946,277 (GRCm39) missense probably damaging 0.97
R4981:Dennd5b UTSW 6 148,911,270 (GRCm39) missense possibly damaging 0.88
R4994:Dennd5b UTSW 6 148,942,998 (GRCm39) splice site probably null
R5400:Dennd5b UTSW 6 148,901,514 (GRCm39) missense probably damaging 1.00
R5452:Dennd5b UTSW 6 148,943,011 (GRCm39) splice site probably null
R5548:Dennd5b UTSW 6 148,920,847 (GRCm39) splice site probably null
R5841:Dennd5b UTSW 6 148,946,253 (GRCm39) missense probably benign 0.11
R5996:Dennd5b UTSW 6 148,969,593 (GRCm39) missense probably benign 0.22
R6082:Dennd5b UTSW 6 148,970,193 (GRCm39) missense probably damaging 0.99
R6556:Dennd5b UTSW 6 148,915,749 (GRCm39) splice site probably null
R6812:Dennd5b UTSW 6 148,982,630 (GRCm39) start gained probably benign
R6828:Dennd5b UTSW 6 148,895,244 (GRCm39) missense probably damaging 0.99
R7104:Dennd5b UTSW 6 148,946,102 (GRCm39) missense probably damaging 1.00
R7231:Dennd5b UTSW 6 148,946,102 (GRCm39) missense probably damaging 1.00
R7325:Dennd5b UTSW 6 148,922,068 (GRCm39) missense probably benign 0.00
R7399:Dennd5b UTSW 6 148,937,981 (GRCm39) missense probably damaging 1.00
R7516:Dennd5b UTSW 6 148,969,878 (GRCm39) missense probably benign 0.02
R7751:Dennd5b UTSW 6 148,918,604 (GRCm39) missense probably benign 0.01
R7763:Dennd5b UTSW 6 148,970,156 (GRCm39) missense probably damaging 1.00
R7770:Dennd5b UTSW 6 148,943,214 (GRCm39) missense probably damaging 0.99
R7788:Dennd5b UTSW 6 148,970,064 (GRCm39) missense probably benign 0.00
R7854:Dennd5b UTSW 6 148,969,964 (GRCm39) missense probably benign 0.00
R7899:Dennd5b UTSW 6 148,943,159 (GRCm39) missense probably damaging 1.00
R8226:Dennd5b UTSW 6 148,915,746 (GRCm39) splice site probably null
R8328:Dennd5b UTSW 6 148,922,115 (GRCm39) missense probably damaging 1.00
R8489:Dennd5b UTSW 6 148,986,389 (GRCm39) missense probably benign 0.00
R8517:Dennd5b UTSW 6 148,930,619 (GRCm39) missense probably damaging 1.00
R8556:Dennd5b UTSW 6 148,895,268 (GRCm39) missense probably damaging 1.00
R8693:Dennd5b UTSW 6 148,911,272 (GRCm39) nonsense probably null
R8946:Dennd5b UTSW 6 148,943,485 (GRCm39) intron probably benign
R8966:Dennd5b UTSW 6 148,901,474 (GRCm39) missense probably damaging 1.00
R9122:Dennd5b UTSW 6 148,908,240 (GRCm39) missense
R9178:Dennd5b UTSW 6 148,934,844 (GRCm39) nonsense probably null
R9208:Dennd5b UTSW 6 149,002,698 (GRCm39) missense probably benign 0.09
R9465:Dennd5b UTSW 6 148,908,260 (GRCm39) missense probably damaging 1.00
R9535:Dennd5b UTSW 6 148,895,365 (GRCm39) missense probably benign 0.03
R9541:Dennd5b UTSW 6 148,899,872 (GRCm39) missense probably benign 0.00
R9731:Dennd5b UTSW 6 148,970,138 (GRCm39) missense probably damaging 1.00
R9760:Dennd5b UTSW 6 148,969,997 (GRCm39) missense probably benign 0.14
R9783:Dennd5b UTSW 6 148,911,342 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATTTCAGTGACCTCCCAGGAGGC -3'
(R):5'- GGGAAGATGGTTCTCGCACCTATG -3'

Sequencing Primer
(F):5'- TGGATATAGCTCTCAAGCGGC -3'
(R):5'- GTTCTCGCACCTATGGTTTTG -3'
Posted On 2014-01-29