Incidental Mutation 'R1241:Cd209e'
ID151999
Institutional Source Beutler Lab
Gene Symbol Cd209e
Ensembl Gene ENSMUSG00000040197
Gene NameCD209e antigen
SynonymsmSIGNR4, SIGNR4
MMRRC Submission 039308-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.048) question?
Stock #R1241 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location3847965-3854309 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 3849124 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 196 (I196N)
Ref Sequence ENSEMBL: ENSMUSP00000033888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033888]
Predicted Effect probably damaging
Transcript: ENSMUST00000033888
AA Change: I196N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000033888
Gene: ENSMUSG00000040197
AA Change: I196N

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
CLECT 77 198 4.01e-33 SMART
Meta Mutation Damage Score 0.8604 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane receptor and is often referred to as DC-SIGN because of its expression on the surface of dendritic cells and macrophages. The encoded protein is involved in the innate immune system and recognizes numerous evolutionarily divergent pathogens ranging from parasites to viruses with a large impact on public health. The protein is organized into three distinct domains: an N-terminal transmembrane domain, a tandem-repeat neck domain and C-type lectin carbohydrate recognition domain. The extracellular region consisting of the C-type lectin and neck domains has a dual function as a pathogen recognition receptor and a cell adhesion receptor by binding carbohydrate ligands on the surface of microbes and endogenous cells. The neck region is important for homo-oligomerization which allows the receptor to bind multivalent ligands with high avidity. Variations in the number of 23 amino acid repeats in the neck domain of this protein are rare but have a significant impact on ligand binding ability. This gene is closely related in terms of both sequence and function to a neighboring gene (GeneID 10332; often referred to as L-SIGN). DC-SIGN and L-SIGN differ in their ligand-binding properties and distribution. Alternative splicing results in multiple variants.[provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,505 S119N probably benign Het
9030619P08Rik A C 15: 75,429,997 noncoding transcript Het
Aldh1l2 T C 10: 83,496,025 I639V probably benign Het
Ambra1 T C 2: 91,770,896 probably benign Het
Ap5z1 T C 5: 142,470,114 Y299H probably damaging Het
Atp6v1b1 A T 6: 83,756,544 probably benign Het
Atr G A 9: 95,950,636 V2574I probably benign Het
Atxn1l T A 8: 109,732,980 T217S probably benign Het
Ccdc85a A G 11: 28,396,150 S89P probably benign Het
Cdhr4 A G 9: 107,995,296 S247G probably benign Het
Cntn6 A T 6: 104,832,509 I502F probably damaging Het
Crisp4 T C 1: 18,122,794 Y233C probably damaging Het
Ctsb C A 14: 63,139,104 T261N probably benign Het
Ctsk T C 3: 95,500,874 F14L probably benign Het
Dchs1 T C 7: 105,758,178 I2110V probably damaging Het
Dennd5b A G 6: 149,068,490 M155T probably benign Het
Echdc3 T C 2: 6,212,800 D54G probably benign Het
Egln3 G A 12: 54,181,693 T209I probably damaging Het
Fbn1 A C 2: 125,372,527 probably benign Het
Fkbp15 A T 4: 62,304,609 S1018T possibly damaging Het
Flnb T C 14: 7,896,503 I898T probably benign Het
Flt1 T A 5: 147,599,646 Y795F probably damaging Het
Flt4 C T 11: 49,636,339 probably benign Het
Fryl A G 5: 73,064,925 probably benign Het
Fryl T C 5: 73,110,271 E417G probably damaging Het
Gcnt3 T C 9: 70,034,333 I318V probably benign Het
Gm11437 T A 11: 84,164,628 H54L possibly damaging Het
Huwe1 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA X: 151,907,048 probably benign Het
Jarid2 G A 13: 44,884,892 probably benign Het
Kif5b A T 18: 6,214,044 V653E probably benign Het
Kmt2b A G 7: 30,574,940 V2113A probably damaging Het
Knl1 C T 2: 119,072,573 T1585I probably benign Het
Mlxipl T A 5: 135,132,718 M497K probably benign Het
Mre11a T A 9: 14,799,639 W210R probably damaging Het
Mrps22 A G 9: 98,594,695 V207A probably benign Het
Myo15 A G 11: 60,499,430 I2111V possibly damaging Het
Myo1a C T 10: 127,719,279 P838L probably benign Het
Nbea T A 3: 56,058,040 H484L probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nlrp2 T A 7: 5,328,431 D322V probably damaging Het
Nrcam T C 12: 44,590,164 C1057R probably damaging Het
Ntsr1 T C 2: 180,500,601 S62P probably damaging Het
Nudt18 A G 14: 70,579,427 H157R probably benign Het
Olfr1002 T A 2: 85,647,560 T254S probably damaging Het
Olfr982 C A 9: 40,074,896 N200K probably damaging Het
Sidt2 T C 9: 45,945,704 T435A probably damaging Het
Snx27 T C 3: 94,520,233 T312A probably benign Het
Srebf2 T C 15: 82,177,519 S429P probably damaging Het
Suclg2 A G 6: 95,497,582 probably benign Het
Tchh A T 3: 93,444,972 E573V unknown Het
Tdrd1 A G 19: 56,861,760 T985A probably benign Het
Ttc7b A G 12: 100,403,439 I357T possibly damaging Het
Ttn T C 2: 76,795,664 E13271G probably damaging Het
Usp13 A G 3: 32,915,708 E661G probably damaging Het
Vasp T G 7: 19,259,033 probably benign Het
Vmn2r109 A T 17: 20,555,241 Y75N possibly damaging Het
Vmn2r15 T A 5: 109,292,904 N363Y probably damaging Het
Vmn2r60 T A 7: 42,137,052 N426K probably benign Het
Wisp2 T A 2: 163,829,077 M168K unknown Het
Znhit2 C A 19: 6,062,258 N344K probably damaging Het
Other mutations in Cd209e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00833:Cd209e APN 8 3852800 missense probably benign 0.05
IGL00920:Cd209e APN 8 3849187 missense probably damaging 1.00
IGL01132:Cd209e APN 8 3851274 missense probably benign 0.18
IGL02499:Cd209e APN 8 3854238 missense probably benign
R0124:Cd209e UTSW 8 3851274 missense probably benign 0.08
R0268:Cd209e UTSW 8 3849125 missense probably benign 0.34
R0540:Cd209e UTSW 8 3851265 missense probably benign 0.04
R0744:Cd209e UTSW 8 3853205 missense probably benign 0.00
R0836:Cd209e UTSW 8 3853205 missense probably benign 0.00
R1367:Cd209e UTSW 8 3849084 makesense probably null
R2040:Cd209e UTSW 8 3849158 missense probably damaging 1.00
R2136:Cd209e UTSW 8 3853248 missense probably benign 0.00
R4787:Cd209e UTSW 8 3851181 missense probably null 0.69
R6283:Cd209e UTSW 8 3849212 nonsense probably null
R6338:Cd209e UTSW 8 3849154 missense probably damaging 1.00
R6894:Cd209e UTSW 8 3853569 missense possibly damaging 0.48
Z1176:Cd209e UTSW 8 3849196 missense probably benign 0.30
Z1177:Cd209e UTSW 8 3851181 missense probably null 0.99
Predicted Primers PCR Primer
(F):5'- AGGAGACTGATGAGTCCCAGAGGTAA -3'
(R):5'- AAGACTTCATACGATGCAGGTAGCAC -3'

Sequencing Primer
(F):5'- GTCCCAGAGGTAATACTAAGATTTCC -3'
(R):5'- gttttcaacagtgttttcaatgttc -3'
Posted On2014-01-29