Incidental Mutation 'R1241:Cdhr4'
ID152008
Institutional Source Beutler Lab
Gene Symbol Cdhr4
Ensembl Gene ENSMUSG00000032595
Gene Namecadherin-related family member 4
SynonymsCdh29, 1700021K14Rik, D330022A01Rik
MMRRC Submission 039308-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R1241 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location107992497-107999684 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107995296 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 247 (S247G)
Ref Sequence ENSEMBL: ENSMUSP00000135184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000175759] [ENSMUST00000176306] [ENSMUST00000176356] [ENSMUST00000176373] [ENSMUST00000177173] [ENSMUST00000177368] [ENSMUST00000177508]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000035215
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175729
Predicted Effect probably benign
Transcript: ENSMUST00000175759
SMART Domains Protein: ENSMUSP00000135743
Gene: ENSMUSG00000032595

DomainStartEndE-ValueType
Blast:CA 3 104 4e-44 BLAST
SCOP:d1l3wa3 59 104 4e-7 SMART
transmembrane domain 125 147 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175802
SMART Domains Protein: ENSMUSP00000135003
Gene: ENSMUSG00000032595

DomainStartEndE-ValueType
CA 33 116 5.4e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175891
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176166
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176183
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176196
Predicted Effect probably benign
Transcript: ENSMUST00000176306
Predicted Effect probably benign
Transcript: ENSMUST00000176334
Predicted Effect probably benign
Transcript: ENSMUST00000176356
Predicted Effect probably benign
Transcript: ENSMUST00000176373
SMART Domains Protein: ENSMUSP00000134896
Gene: ENSMUSG00000032595

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176382
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176454
Predicted Effect probably benign
Transcript: ENSMUST00000176459
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176919
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177093
Predicted Effect probably benign
Transcript: ENSMUST00000177173
AA Change: S247G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000135184
Gene: ENSMUSG00000032595
AA Change: S247G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 80 91 N/A INTRINSIC
Blast:CA 149 224 2e-9 BLAST
Blast:CA 252 330 3e-33 BLAST
CA 354 437 2.24e-1 SMART
CA 459 542 5.86e-17 SMART
Blast:CA 566 649 3e-40 BLAST
transmembrane domain 680 702 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177226
Predicted Effect probably benign
Transcript: ENSMUST00000177368
SMART Domains Protein: ENSMUSP00000135553
Gene: ENSMUSG00000079323

DomainStartEndE-ValueType
Blast:UBA_e1_C 1 39 1e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000177508
SMART Domains Protein: ENSMUSP00000135332
Gene: ENSMUSG00000032595

DomainStartEndE-ValueType
Blast:CA 1 29 4e-7 BLAST
transmembrane domain 60 82 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177516
Meta Mutation Damage Score 0.1467 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,505 S119N probably benign Het
9030619P08Rik A C 15: 75,429,997 noncoding transcript Het
Aldh1l2 T C 10: 83,496,025 I639V probably benign Het
Ambra1 T C 2: 91,770,896 probably benign Het
Ap5z1 T C 5: 142,470,114 Y299H probably damaging Het
Atp6v1b1 A T 6: 83,756,544 probably benign Het
Atr G A 9: 95,950,636 V2574I probably benign Het
Atxn1l T A 8: 109,732,980 T217S probably benign Het
Ccdc85a A G 11: 28,396,150 S89P probably benign Het
Cd209e A T 8: 3,849,124 I196N probably damaging Het
Cntn6 A T 6: 104,832,509 I502F probably damaging Het
Crisp4 T C 1: 18,122,794 Y233C probably damaging Het
Ctsb C A 14: 63,139,104 T261N probably benign Het
Ctsk T C 3: 95,500,874 F14L probably benign Het
Dchs1 T C 7: 105,758,178 I2110V probably damaging Het
Dennd5b A G 6: 149,068,490 M155T probably benign Het
Echdc3 T C 2: 6,212,800 D54G probably benign Het
Egln3 G A 12: 54,181,693 T209I probably damaging Het
Fbn1 A C 2: 125,372,527 probably benign Het
Fkbp15 A T 4: 62,304,609 S1018T possibly damaging Het
Flnb T C 14: 7,896,503 I898T probably benign Het
Flt1 T A 5: 147,599,646 Y795F probably damaging Het
Flt4 C T 11: 49,636,339 probably benign Het
Fryl A G 5: 73,064,925 probably benign Het
Fryl T C 5: 73,110,271 E417G probably damaging Het
Gcnt3 T C 9: 70,034,333 I318V probably benign Het
Gm11437 T A 11: 84,164,628 H54L possibly damaging Het
Huwe1 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA X: 151,907,048 probably benign Het
Jarid2 G A 13: 44,884,892 probably benign Het
Kif5b A T 18: 6,214,044 V653E probably benign Het
Kmt2b A G 7: 30,574,940 V2113A probably damaging Het
Knl1 C T 2: 119,072,573 T1585I probably benign Het
Mlxipl T A 5: 135,132,718 M497K probably benign Het
Mre11a T A 9: 14,799,639 W210R probably damaging Het
Mrps22 A G 9: 98,594,695 V207A probably benign Het
Myo15 A G 11: 60,499,430 I2111V possibly damaging Het
Myo1a C T 10: 127,719,279 P838L probably benign Het
Nbea T A 3: 56,058,040 H484L probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nlrp2 T A 7: 5,328,431 D322V probably damaging Het
Nrcam T C 12: 44,590,164 C1057R probably damaging Het
Ntsr1 T C 2: 180,500,601 S62P probably damaging Het
Nudt18 A G 14: 70,579,427 H157R probably benign Het
Olfr1002 T A 2: 85,647,560 T254S probably damaging Het
Olfr982 C A 9: 40,074,896 N200K probably damaging Het
Sidt2 T C 9: 45,945,704 T435A probably damaging Het
Snx27 T C 3: 94,520,233 T312A probably benign Het
Srebf2 T C 15: 82,177,519 S429P probably damaging Het
Suclg2 A G 6: 95,497,582 probably benign Het
Tchh A T 3: 93,444,972 E573V unknown Het
Tdrd1 A G 19: 56,861,760 T985A probably benign Het
Ttc7b A G 12: 100,403,439 I357T possibly damaging Het
Ttn T C 2: 76,795,664 E13271G probably damaging Het
Usp13 A G 3: 32,915,708 E661G probably damaging Het
Vasp T G 7: 19,259,033 probably benign Het
Vmn2r109 A T 17: 20,555,241 Y75N possibly damaging Het
Vmn2r15 T A 5: 109,292,904 N363Y probably damaging Het
Vmn2r60 T A 7: 42,137,052 N426K probably benign Het
Wisp2 T A 2: 163,829,077 M168K unknown Het
Znhit2 C A 19: 6,062,258 N344K probably damaging Het
Other mutations in Cdhr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Cdhr4 APN 9 107999545 missense probably damaging 1.00
IGL01105:Cdhr4 APN 9 107995861 unclassified probably benign
IGL02097:Cdhr4 APN 9 107993000 missense probably benign 0.17
IGL02441:Cdhr4 APN 9 107993267 missense possibly damaging 0.84
IGL02635:Cdhr4 APN 9 107992871 missense probably benign 0.04
IGL02870:Cdhr4 APN 9 107998064 critical splice donor site probably null
IGL03160:Cdhr4 APN 9 107995869 missense probably benign 0.05
IGL03162:Cdhr4 APN 9 107998011 missense probably damaging 1.00
IGL03250:Cdhr4 APN 9 107996659 missense probably damaging 0.99
R0233:Cdhr4 UTSW 9 107996934 missense probably benign 0.25
R0233:Cdhr4 UTSW 9 107996934 missense probably benign 0.25
R1250:Cdhr4 UTSW 9 107997516 missense probably damaging 1.00
R2102:Cdhr4 UTSW 9 107998007 missense probably damaging 1.00
R2104:Cdhr4 UTSW 9 107996261 missense probably damaging 0.97
R2106:Cdhr4 UTSW 9 107997494 missense possibly damaging 0.75
R2108:Cdhr4 UTSW 9 107997644 missense probably damaging 1.00
R2171:Cdhr4 UTSW 9 107992918 missense probably benign 0.00
R2312:Cdhr4 UTSW 9 107995287 missense probably benign 0.00
R4106:Cdhr4 UTSW 9 107996260 missense probably damaging 1.00
R4515:Cdhr4 UTSW 9 107992951 missense probably benign 0.31
R4686:Cdhr4 UTSW 9 107995684 missense probably benign 0.00
R4799:Cdhr4 UTSW 9 107998699 splice site probably benign
R5165:Cdhr4 UTSW 9 107997630 missense probably damaging 1.00
R5478:Cdhr4 UTSW 9 107995591 missense possibly damaging 0.61
R5574:Cdhr4 UTSW 9 107993328 unclassified probably benign
R7387:Cdhr4 UTSW 9 107996912 nonsense probably null
R7609:Cdhr4 UTSW 9 107997283 missense probably damaging 0.99
R7663:Cdhr4 UTSW 9 107998772 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGAAGGTTTTGCCTGCACCCTC -3'
(R):5'- TCAGGAAGGAGTCACATCTGTGCC -3'

Sequencing Primer
(F):5'- CCTTTACCCTGGGAATGAACG -3'
(R):5'- CTCGCCCTTTCCCAGTTAAG -3'
Posted On2014-01-29