Incidental Mutation 'R1241:Myo15a'
ID 152013
Institutional Source Beutler Lab
Gene Symbol Myo15a
Ensembl Gene ENSMUSG00000042678
Gene Name myosin XVA
Synonyms Myo15
MMRRC Submission 039308-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1241 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 60360165-60419195 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 60390256 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 2111 (I2111V)
Ref Sequence ENSEMBL: ENSMUSP00000071777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071880] [ENSMUST00000081823] [ENSMUST00000094135]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000071880
AA Change: I2111V

PolyPhen 2 Score 0.579 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000071777
Gene: ENSMUSG00000042678
AA Change: I2111V

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 87 100 N/A INTRINSIC
low complexity region 107 120 N/A INTRINSIC
low complexity region 269 292 N/A INTRINSIC
low complexity region 295 306 N/A INTRINSIC
low complexity region 311 325 N/A INTRINSIC
low complexity region 349 384 N/A INTRINSIC
low complexity region 425 435 N/A INTRINSIC
low complexity region 487 498 N/A INTRINSIC
low complexity region 502 509 N/A INTRINSIC
low complexity region 653 681 N/A INTRINSIC
low complexity region 692 705 N/A INTRINSIC
low complexity region 737 747 N/A INTRINSIC
low complexity region 758 775 N/A INTRINSIC
low complexity region 781 792 N/A INTRINSIC
low complexity region 796 809 N/A INTRINSIC
low complexity region 825 849 N/A INTRINSIC
low complexity region 883 897 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
low complexity region 1115 1130 N/A INTRINSIC
MYSc 1200 1884 N/A SMART
IQ 1885 1907 1.63e-1 SMART
IQ 1908 1930 1.77e-2 SMART
IQ 1931 1953 2.97e2 SMART
low complexity region 1955 1974 N/A INTRINSIC
low complexity region 1992 2006 N/A INTRINSIC
MyTH4 2049 2195 1.8e-42 SMART
low complexity region 2396 2405 N/A INTRINSIC
low complexity region 2451 2461 N/A INTRINSIC
Blast:MYSc 2665 2848 2e-14 BLAST
SH3 2851 2933 1.55e-4 SMART
low complexity region 2949 2962 N/A INTRINSIC
MyTH4 3031 3185 5.59e-48 SMART
B41 3188 3400 6.94e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000081823
AA Change: I906V

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000080507
Gene: ENSMUSG00000042678
AA Change: I906V

DomainStartEndE-ValueType
MYSc 13 697 N/A SMART
IQ 698 720 1.63e-1 SMART
IQ 721 743 1.77e-2 SMART
IQ 744 766 2.97e2 SMART
low complexity region 787 801 N/A INTRINSIC
MyTH4 844 990 1.8e-42 SMART
low complexity region 1191 1200 N/A INTRINSIC
low complexity region 1246 1256 N/A INTRINSIC
Blast:MYSc 1460 1643 7e-15 BLAST
SH3 1646 1728 1.55e-4 SMART
low complexity region 1744 1757 N/A INTRINSIC
MyTH4 1826 1980 5.59e-48 SMART
B41 1983 2195 6.94e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000094135
AA Change: I2093V

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000091686
Gene: ENSMUSG00000042678
AA Change: I2093V

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 87 100 N/A INTRINSIC
low complexity region 107 120 N/A INTRINSIC
low complexity region 269 292 N/A INTRINSIC
low complexity region 295 306 N/A INTRINSIC
low complexity region 311 325 N/A INTRINSIC
low complexity region 349 384 N/A INTRINSIC
low complexity region 425 435 N/A INTRINSIC
low complexity region 487 498 N/A INTRINSIC
low complexity region 502 509 N/A INTRINSIC
low complexity region 653 681 N/A INTRINSIC
low complexity region 692 705 N/A INTRINSIC
low complexity region 737 747 N/A INTRINSIC
low complexity region 758 775 N/A INTRINSIC
low complexity region 781 792 N/A INTRINSIC
low complexity region 796 809 N/A INTRINSIC
low complexity region 825 849 N/A INTRINSIC
low complexity region 883 897 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
low complexity region 1115 1130 N/A INTRINSIC
MYSc 1200 1884 N/A SMART
IQ 1885 1907 1.63e-1 SMART
IQ 1908 1930 1.77e-2 SMART
IQ 1931 1953 2.97e2 SMART
low complexity region 1974 1988 N/A INTRINSIC
MyTH4 2031 2177 1.8e-42 SMART
low complexity region 2378 2387 N/A INTRINSIC
low complexity region 2433 2443 N/A INTRINSIC
Blast:MYSc 2647 2830 2e-14 BLAST
SH3 2833 2915 1.55e-4 SMART
low complexity region 2931 2944 N/A INTRINSIC
MyTH4 3013 3167 5.59e-48 SMART
B41 3170 3382 6.94e-3 SMART
Predicted Effect unknown
Transcript: ENSMUST00000126522
AA Change: I924V
SMART Domains Protein: ENSMUSP00000120839
Gene: ENSMUSG00000042678
AA Change: I924V

DomainStartEndE-ValueType
MYSc 34 716 N/A SMART
IQ 717 739 1.63e-1 SMART
IQ 740 762 1.77e-2 SMART
IQ 763 785 2.97e2 SMART
low complexity region 806 820 N/A INTRINSIC
MyTH4 863 1009 1.8e-42 SMART
low complexity region 1210 1219 N/A INTRINSIC
low complexity region 1265 1275 N/A INTRINSIC
Blast:MYSc 1479 1662 5e-15 BLAST
SH3 1665 1747 1.55e-4 SMART
low complexity region 1763 1776 N/A INTRINSIC
Meta Mutation Damage Score 0.1145 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an unconventional myosin. This protein differs from other myosins in that it has a long N-terminal extension preceding the conserved motor domain. Studies in mice suggest that this protein is necessary for actin organization in the hair cells of the cochlea. Mutations in this gene have been associated with profound, congenital, neurosensory, nonsyndromal deafness. This gene is located within the Smith-Magenis syndrome region on chromosome 17. Read-through transcripts containing an upstream gene and this gene have been identified, but they are not thought to encode a fusion protein. Several alternatively spliced transcript variants have been described, but their full length sequences have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in profound deafness and neurological behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 183,765,702 (GRCm39) S119N probably benign Het
9030619P08Rik A C 15: 75,301,846 (GRCm39) noncoding transcript Het
Aldh1l2 T C 10: 83,331,889 (GRCm39) I639V probably benign Het
Ambra1 T C 2: 91,601,241 (GRCm39) probably benign Het
Ap5z1 T C 5: 142,455,869 (GRCm39) Y299H probably damaging Het
Atp6v1b1 A T 6: 83,733,526 (GRCm39) probably benign Het
Atr G A 9: 95,832,689 (GRCm39) V2574I probably benign Het
Atxn1l T A 8: 110,459,612 (GRCm39) T217S probably benign Het
Ccdc85a A G 11: 28,346,150 (GRCm39) S89P probably benign Het
Ccn5 T A 2: 163,670,997 (GRCm39) M168K unknown Het
Cd209e A T 8: 3,899,124 (GRCm39) I196N probably damaging Het
Cdhr4 A G 9: 107,872,495 (GRCm39) S247G probably benign Het
Cntn6 A T 6: 104,809,470 (GRCm39) I502F probably damaging Het
Crisp4 T C 1: 18,193,018 (GRCm39) Y233C probably damaging Het
Ctsb C A 14: 63,376,553 (GRCm39) T261N probably benign Het
Ctsk T C 3: 95,408,185 (GRCm39) F14L probably benign Het
Dchs1 T C 7: 105,407,385 (GRCm39) I2110V probably damaging Het
Dennd5b A G 6: 148,969,988 (GRCm39) M155T probably benign Het
Echdc3 T C 2: 6,217,611 (GRCm39) D54G probably benign Het
Egln3 G A 12: 54,228,479 (GRCm39) T209I probably damaging Het
Fbn1 A C 2: 125,214,447 (GRCm39) probably benign Het
Fkbp15 A T 4: 62,222,846 (GRCm39) S1018T possibly damaging Het
Flnb T C 14: 7,896,503 (GRCm38) I898T probably benign Het
Flt1 T A 5: 147,536,456 (GRCm39) Y795F probably damaging Het
Flt4 C T 11: 49,527,166 (GRCm39) probably benign Het
Fryl T C 5: 73,267,614 (GRCm39) E417G probably damaging Het
Fryl A G 5: 73,222,268 (GRCm39) probably benign Het
Gcnt3 T C 9: 69,941,615 (GRCm39) I318V probably benign Het
Gm11437 T A 11: 84,055,454 (GRCm39) H54L possibly damaging Het
Huwe1 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA X: 150,690,044 (GRCm39) probably benign Het
Jarid2 G A 13: 45,038,368 (GRCm39) probably benign Het
Kif5b A T 18: 6,214,044 (GRCm39) V653E probably benign Het
Kmt2b A G 7: 30,274,365 (GRCm39) V2113A probably damaging Het
Knl1 C T 2: 118,903,054 (GRCm39) T1585I probably benign Het
Mlxipl T A 5: 135,161,572 (GRCm39) M497K probably benign Het
Mre11a T A 9: 14,710,935 (GRCm39) W210R probably damaging Het
Mrps22 A G 9: 98,476,748 (GRCm39) V207A probably benign Het
Myo1a C T 10: 127,555,148 (GRCm39) P838L probably benign Het
Nbea T A 3: 55,965,461 (GRCm39) H484L probably damaging Het
Nfix G A 8: 85,453,155 (GRCm39) R300C probably damaging Het
Nlrp2 T A 7: 5,331,430 (GRCm39) D322V probably damaging Het
Nrcam T C 12: 44,636,947 (GRCm39) C1057R probably damaging Het
Ntsr1 T C 2: 180,142,394 (GRCm39) S62P probably damaging Het
Nudt18 A G 14: 70,816,867 (GRCm39) H157R probably benign Het
Or10s1 C A 9: 39,986,192 (GRCm39) N200K probably damaging Het
Or5g25 T A 2: 85,477,904 (GRCm39) T254S probably damaging Het
Sidt2 T C 9: 45,857,002 (GRCm39) T435A probably damaging Het
Snx27 T C 3: 94,427,540 (GRCm39) T312A probably benign Het
Srebf2 T C 15: 82,061,720 (GRCm39) S429P probably damaging Het
Suclg2 A G 6: 95,474,563 (GRCm39) probably benign Het
Tchh A T 3: 93,352,279 (GRCm39) E573V unknown Het
Tdrd1 A G 19: 56,850,192 (GRCm39) T985A probably benign Het
Ttc7b A G 12: 100,369,698 (GRCm39) I357T possibly damaging Het
Ttn T C 2: 76,626,008 (GRCm39) E13271G probably damaging Het
Usp13 A G 3: 32,969,857 (GRCm39) E661G probably damaging Het
Vasp T G 7: 18,992,958 (GRCm39) probably benign Het
Vmn2r109 A T 17: 20,775,503 (GRCm39) Y75N possibly damaging Het
Vmn2r15 T A 5: 109,440,770 (GRCm39) N363Y probably damaging Het
Vmn2r60 T A 7: 41,786,476 (GRCm39) N426K probably benign Het
Znhit2 C A 19: 6,112,288 (GRCm39) N344K probably damaging Het
Other mutations in Myo15a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00845:Myo15a APN 11 60,368,605 (GRCm39) missense probably damaging 1.00
IGL01011:Myo15a APN 11 60,367,818 (GRCm39) missense probably benign 0.33
IGL01100:Myo15a APN 11 60,401,984 (GRCm39) missense probably damaging 1.00
IGL01357:Myo15a APN 11 60,393,115 (GRCm39) splice site probably benign
IGL01634:Myo15a APN 11 60,386,298 (GRCm39) missense probably damaging 1.00
IGL01763:Myo15a APN 11 60,412,564 (GRCm39) missense probably benign 0.07
IGL01901:Myo15a APN 11 60,418,260 (GRCm39) utr 3 prime probably benign
IGL01931:Myo15a APN 11 60,386,964 (GRCm39) missense probably damaging 1.00
IGL02006:Myo15a APN 11 60,401,954 (GRCm39) missense probably damaging 1.00
IGL02041:Myo15a APN 11 60,397,689 (GRCm39) missense probably damaging 0.99
IGL02094:Myo15a APN 11 60,401,473 (GRCm39) unclassified probably benign
IGL02122:Myo15a APN 11 60,374,292 (GRCm39) missense probably benign 0.23
IGL02153:Myo15a APN 11 60,389,223 (GRCm39) missense probably damaging 1.00
IGL02328:Myo15a APN 11 60,417,433 (GRCm39) missense probably benign 0.13
IGL02330:Myo15a APN 11 60,367,987 (GRCm39) missense possibly damaging 0.94
IGL02431:Myo15a APN 11 60,401,465 (GRCm39) missense possibly damaging 0.73
IGL02639:Myo15a APN 11 60,369,447 (GRCm39) missense probably benign
IGL02659:Myo15a APN 11 60,382,609 (GRCm39) splice site probably benign
IGL02800:Myo15a APN 11 60,393,195 (GRCm39) missense probably damaging 1.00
IGL02812:Myo15a APN 11 60,368,005 (GRCm39) missense probably benign 0.15
IGL02863:Myo15a APN 11 60,368,953 (GRCm39) missense probably damaging 1.00
IGL02873:Myo15a APN 11 60,374,308 (GRCm39) missense probably damaging 1.00
IGL02990:Myo15a APN 11 60,370,266 (GRCm39) missense probably benign 0.02
IGL03011:Myo15a APN 11 60,400,357 (GRCm39) splice site probably benign
IGL03243:Myo15a APN 11 60,387,344 (GRCm39) missense probably damaging 1.00
IGL03297:Myo15a APN 11 60,369,967 (GRCm39) missense probably damaging 1.00
novichok UTSW 11 60,372,566 (GRCm39) critical splice donor site probably null
parker UTSW 11 60,411,740 (GRCm39) critical splice donor site probably null
Typhoon UTSW 11 60,378,251 (GRCm39) critical splice donor site probably null
PIT4131001:Myo15a UTSW 11 60,386,280 (GRCm39) missense probably damaging 1.00
PIT4131001:Myo15a UTSW 11 60,373,953 (GRCm39) missense probably damaging 1.00
R0133:Myo15a UTSW 11 60,368,676 (GRCm39) missense possibly damaging 0.94
R0265:Myo15a UTSW 11 60,405,723 (GRCm39) critical splice acceptor site probably null
R0389:Myo15a UTSW 11 60,369,364 (GRCm39) missense probably benign
R0416:Myo15a UTSW 11 60,402,000 (GRCm39) missense probably damaging 1.00
R0449:Myo15a UTSW 11 60,400,422 (GRCm39) missense possibly damaging 0.92
R0477:Myo15a UTSW 11 60,411,740 (GRCm39) critical splice donor site probably null
R0543:Myo15a UTSW 11 60,369,877 (GRCm39) missense probably benign
R0546:Myo15a UTSW 11 60,397,139 (GRCm39) missense probably damaging 1.00
R0555:Myo15a UTSW 11 60,412,464 (GRCm39) missense probably damaging 1.00
R0639:Myo15a UTSW 11 60,370,162 (GRCm39) missense probably benign 0.12
R0723:Myo15a UTSW 11 60,369,803 (GRCm39) missense possibly damaging 0.94
R0837:Myo15a UTSW 11 60,378,077 (GRCm39) missense probably damaging 0.98
R0865:Myo15a UTSW 11 60,382,514 (GRCm39) missense probably damaging 1.00
R0899:Myo15a UTSW 11 60,368,011 (GRCm39) missense possibly damaging 0.87
R1022:Myo15a UTSW 11 60,370,442 (GRCm39) missense probably benign 0.00
R1024:Myo15a UTSW 11 60,370,442 (GRCm39) missense probably benign 0.00
R1035:Myo15a UTSW 11 60,401,384 (GRCm39) unclassified probably benign
R1109:Myo15a UTSW 11 60,383,892 (GRCm39) missense probably damaging 1.00
R1170:Myo15a UTSW 11 60,370,233 (GRCm39) missense probably benign 0.04
R1392:Myo15a UTSW 11 60,368,800 (GRCm39) missense possibly damaging 0.95
R1392:Myo15a UTSW 11 60,368,800 (GRCm39) missense possibly damaging 0.95
R1434:Myo15a UTSW 11 60,395,157 (GRCm39) missense probably benign 0.00
R1450:Myo15a UTSW 11 60,386,308 (GRCm39) missense probably damaging 1.00
R1456:Myo15a UTSW 11 60,399,028 (GRCm39) missense probably damaging 1.00
R1468:Myo15a UTSW 11 60,396,832 (GRCm39) missense probably damaging 1.00
R1468:Myo15a UTSW 11 60,396,832 (GRCm39) missense probably damaging 1.00
R1548:Myo15a UTSW 11 60,379,064 (GRCm39) missense probably damaging 1.00
R1551:Myo15a UTSW 11 60,383,791 (GRCm39) missense possibly damaging 0.70
R1571:Myo15a UTSW 11 60,409,290 (GRCm39) missense probably damaging 1.00
R1662:Myo15a UTSW 11 60,392,527 (GRCm39) missense probably damaging 1.00
R1777:Myo15a UTSW 11 60,405,762 (GRCm39) missense probably benign
R1778:Myo15a UTSW 11 60,369,238 (GRCm39) missense possibly damaging 0.57
R1847:Myo15a UTSW 11 60,390,321 (GRCm39) nonsense probably null
R1875:Myo15a UTSW 11 60,398,354 (GRCm39) missense probably damaging 0.99
R1944:Myo15a UTSW 11 60,392,909 (GRCm39) missense probably damaging 0.99
R1945:Myo15a UTSW 11 60,392,909 (GRCm39) missense probably damaging 0.99
R2013:Myo15a UTSW 11 60,385,057 (GRCm39) missense probably damaging 1.00
R2107:Myo15a UTSW 11 60,382,636 (GRCm39) missense probably damaging 1.00
R2108:Myo15a UTSW 11 60,382,636 (GRCm39) missense probably damaging 1.00
R2112:Myo15a UTSW 11 60,384,994 (GRCm39) missense probably damaging 0.99
R2147:Myo15a UTSW 11 60,401,055 (GRCm39) missense possibly damaging 0.66
R2196:Myo15a UTSW 11 60,400,847 (GRCm39) nonsense probably null
R2207:Myo15a UTSW 11 60,396,860 (GRCm39) missense probably benign 0.01
R2245:Myo15a UTSW 11 60,399,925 (GRCm39) missense probably damaging 1.00
R2367:Myo15a UTSW 11 60,408,064 (GRCm39) missense probably damaging 0.99
R2374:Myo15a UTSW 11 60,369,669 (GRCm39) missense possibly damaging 0.88
R2438:Myo15a UTSW 11 60,373,878 (GRCm39) missense probably damaging 1.00
R3154:Myo15a UTSW 11 60,370,186 (GRCm39) splice site probably null
R3423:Myo15a UTSW 11 60,401,126 (GRCm39) critical splice donor site probably null
R3551:Myo15a UTSW 11 60,400,489 (GRCm39) missense possibly damaging 0.93
R3552:Myo15a UTSW 11 60,400,489 (GRCm39) missense possibly damaging 0.93
R3612:Myo15a UTSW 11 60,368,505 (GRCm39) missense probably damaging 1.00
R3620:Myo15a UTSW 11 60,369,468 (GRCm39) missense possibly damaging 0.63
R3713:Myo15a UTSW 11 60,370,057 (GRCm39) missense possibly damaging 0.55
R3714:Myo15a UTSW 11 60,370,057 (GRCm39) missense possibly damaging 0.55
R3715:Myo15a UTSW 11 60,370,057 (GRCm39) missense possibly damaging 0.55
R3783:Myo15a UTSW 11 60,368,398 (GRCm39) missense probably damaging 0.97
R3784:Myo15a UTSW 11 60,368,398 (GRCm39) missense probably damaging 0.97
R3785:Myo15a UTSW 11 60,368,398 (GRCm39) missense probably damaging 0.97
R3786:Myo15a UTSW 11 60,368,398 (GRCm39) missense probably damaging 0.97
R3787:Myo15a UTSW 11 60,368,398 (GRCm39) missense probably damaging 0.97
R3894:Myo15a UTSW 11 60,395,145 (GRCm39) missense probably benign 0.00
R3962:Myo15a UTSW 11 60,370,654 (GRCm39) missense probably benign 0.00
R4082:Myo15a UTSW 11 60,378,022 (GRCm39) missense possibly damaging 0.92
R4555:Myo15a UTSW 11 60,387,763 (GRCm39) missense probably damaging 1.00
R4641:Myo15a UTSW 11 60,393,867 (GRCm39) missense probably damaging 1.00
R4665:Myo15a UTSW 11 60,395,705 (GRCm39) critical splice acceptor site probably null
R4713:Myo15a UTSW 11 60,370,756 (GRCm39) missense probably benign 0.21
R4820:Myo15a UTSW 11 60,367,741 (GRCm39) missense probably damaging 0.98
R5013:Myo15a UTSW 11 60,382,493 (GRCm39) missense probably damaging 1.00
R5051:Myo15a UTSW 11 60,378,251 (GRCm39) critical splice donor site probably null
R5187:Myo15a UTSW 11 60,394,440 (GRCm39) missense probably damaging 1.00
R5230:Myo15a UTSW 11 60,393,674 (GRCm39) missense possibly damaging 0.68
R5277:Myo15a UTSW 11 60,367,940 (GRCm39) nonsense probably null
R5345:Myo15a UTSW 11 60,388,364 (GRCm39) missense probably damaging 0.99
R5349:Myo15a UTSW 11 60,384,409 (GRCm39) missense probably damaging 1.00
R5356:Myo15a UTSW 11 60,389,192 (GRCm39) missense probably damaging 1.00
R5445:Myo15a UTSW 11 60,411,603 (GRCm39) nonsense probably null
R5477:Myo15a UTSW 11 60,368,503 (GRCm39) missense probably damaging 1.00
R5629:Myo15a UTSW 11 60,370,578 (GRCm39) missense probably benign
R5728:Myo15a UTSW 11 60,379,722 (GRCm39) missense probably damaging 1.00
R5818:Myo15a UTSW 11 60,388,777 (GRCm39) missense probably benign 0.06
R5952:Myo15a UTSW 11 60,370,246 (GRCm39) missense possibly damaging 0.50
R6338:Myo15a UTSW 11 60,368,959 (GRCm39) missense probably damaging 0.99
R6467:Myo15a UTSW 11 60,417,487 (GRCm39) critical splice donor site probably null
R6488:Myo15a UTSW 11 60,369,313 (GRCm39) missense possibly damaging 0.86
R6521:Myo15a UTSW 11 60,393,195 (GRCm39) missense probably damaging 1.00
R6645:Myo15a UTSW 11 60,368,118 (GRCm39) missense probably benign 0.00
R6702:Myo15a UTSW 11 60,383,818 (GRCm39) missense probably benign 0.16
R6703:Myo15a UTSW 11 60,383,818 (GRCm39) missense probably benign 0.16
R6821:Myo15a UTSW 11 60,415,301 (GRCm39) missense probably damaging 1.00
R6882:Myo15a UTSW 11 60,414,832 (GRCm39) missense probably damaging 1.00
R6908:Myo15a UTSW 11 60,396,832 (GRCm39) missense probably damaging 1.00
R6932:Myo15a UTSW 11 60,390,320 (GRCm39) missense probably damaging 1.00
R6958:Myo15a UTSW 11 60,394,451 (GRCm39) missense probably benign 0.07
R7041:Myo15a UTSW 11 60,396,832 (GRCm39) missense probably damaging 1.00
R7149:Myo15a UTSW 11 60,400,836 (GRCm39) missense possibly damaging 0.56
R7163:Myo15a UTSW 11 60,389,195 (GRCm39) missense
R7229:Myo15a UTSW 11 60,387,321 (GRCm39) missense probably benign 0.08
R7347:Myo15a UTSW 11 60,368,787 (GRCm39) missense probably benign
R7368:Myo15a UTSW 11 60,381,741 (GRCm39) splice site probably null
R7392:Myo15a UTSW 11 60,396,802 (GRCm39) missense
R7414:Myo15a UTSW 11 60,374,309 (GRCm39) missense
R7461:Myo15a UTSW 11 60,395,978 (GRCm39) missense
R7609:Myo15a UTSW 11 60,379,637 (GRCm39) missense
R7613:Myo15a UTSW 11 60,395,978 (GRCm39) missense
R7734:Myo15a UTSW 11 60,401,108 (GRCm39) missense probably benign
R7748:Myo15a UTSW 11 60,395,727 (GRCm39) missense
R7767:Myo15a UTSW 11 60,392,922 (GRCm39) missense
R7769:Myo15a UTSW 11 60,399,975 (GRCm39) missense
R7894:Myo15a UTSW 11 60,381,963 (GRCm39) missense
R7919:Myo15a UTSW 11 60,417,356 (GRCm39) missense probably damaging 1.00
R8100:Myo15a UTSW 11 60,408,016 (GRCm39) missense probably damaging 1.00
R8124:Myo15a UTSW 11 60,398,279 (GRCm39) missense
R8129:Myo15a UTSW 11 60,399,026 (GRCm39) missense
R8428:Myo15a UTSW 11 60,387,241 (GRCm39) missense probably damaging 1.00
R8706:Myo15a UTSW 11 60,370,443 (GRCm39) missense probably benign
R8735:Myo15a UTSW 11 60,401,679 (GRCm39) critical splice acceptor site probably null
R8739:Myo15a UTSW 11 60,368,088 (GRCm39) missense probably benign 0.06
R8790:Myo15a UTSW 11 60,378,047 (GRCm39) missense
R8790:Myo15a UTSW 11 60,367,362 (GRCm39) missense possibly damaging 0.73
R8822:Myo15a UTSW 11 60,367,740 (GRCm39) missense probably damaging 0.99
R8907:Myo15a UTSW 11 60,417,434 (GRCm39) missense
R8931:Myo15a UTSW 11 60,368,020 (GRCm39) missense probably benign
R9061:Myo15a UTSW 11 60,393,692 (GRCm39) missense
R9124:Myo15a UTSW 11 60,369,952 (GRCm39) missense probably benign 0.37
R9297:Myo15a UTSW 11 60,385,899 (GRCm39) missense probably null
R9347:Myo15a UTSW 11 60,374,555 (GRCm39) missense
R9417:Myo15a UTSW 11 60,378,243 (GRCm39) missense
R9456:Myo15a UTSW 11 60,392,668 (GRCm39) missense
R9460:Myo15a UTSW 11 60,372,566 (GRCm39) critical splice donor site probably null
R9615:Myo15a UTSW 11 60,374,320 (GRCm39) missense
R9630:Myo15a UTSW 11 60,407,988 (GRCm39) missense probably damaging 1.00
R9746:Myo15a UTSW 11 60,378,234 (GRCm39) nonsense probably null
X0021:Myo15a UTSW 11 60,373,185 (GRCm39) nonsense probably null
X0066:Myo15a UTSW 11 60,369,046 (GRCm39) missense probably damaging 1.00
X0067:Myo15a UTSW 11 60,369,444 (GRCm39) missense possibly damaging 0.88
Z1176:Myo15a UTSW 11 60,389,229 (GRCm39) missense
Z1176:Myo15a UTSW 11 60,379,084 (GRCm39) missense
Z1176:Myo15a UTSW 11 60,415,267 (GRCm39) missense probably damaging 1.00
Z1177:Myo15a UTSW 11 60,386,301 (GRCm39) missense
Z1177:Myo15a UTSW 11 60,379,663 (GRCm39) missense
Z1177:Myo15a UTSW 11 60,368,349 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAATCCTCTGGACCAAATGGAGGC -3'
(R):5'- CTTCTGGCAACACAAAAGCATCGG -3'

Sequencing Primer
(F):5'- TATGAGAGACTTTCCAATAGGCAGC -3'
(R):5'- TGACCTCCAAGCCCCTATTTAG -3'
Posted On 2014-01-29