Incidental Mutation 'R1241:Ttc7b'
ID152017
Institutional Source Beutler Lab
Gene Symbol Ttc7b
Ensembl Gene ENSMUSG00000033530
Gene Nametetratricopeptide repeat domain 7B
SynonymsTtc7l1
MMRRC Submission 039308-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.312) question?
Stock #R1241 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location100300770-100520826 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100403439 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 357 (I357T)
Ref Sequence ENSEMBL: ENSMUSP00000152299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062957] [ENSMUST00000223020]
Predicted Effect possibly damaging
Transcript: ENSMUST00000062957
AA Change: I357T

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000052107
Gene: ENSMUSG00000033530
AA Change: I357T

DomainStartEndE-ValueType
TPR 397 430 8.76e-1 SMART
Blast:TPR 471 514 5e-9 BLAST
TPR 515 548 2.77e1 SMART
TPR 549 582 2.01e0 SMART
TPR 696 729 9.7e0 SMART
TPR 730 763 7.98e-4 SMART
TPR 764 797 6.1e0 SMART
TPR 798 831 2.74e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000223020
AA Change: I357T

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223444
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223514
Meta Mutation Damage Score 0.1126 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,505 S119N probably benign Het
9030619P08Rik A C 15: 75,429,997 noncoding transcript Het
Aldh1l2 T C 10: 83,496,025 I639V probably benign Het
Ambra1 T C 2: 91,770,896 probably benign Het
Ap5z1 T C 5: 142,470,114 Y299H probably damaging Het
Atp6v1b1 A T 6: 83,756,544 probably benign Het
Atr G A 9: 95,950,636 V2574I probably benign Het
Atxn1l T A 8: 109,732,980 T217S probably benign Het
Ccdc85a A G 11: 28,396,150 S89P probably benign Het
Cd209e A T 8: 3,849,124 I196N probably damaging Het
Cdhr4 A G 9: 107,995,296 S247G probably benign Het
Cntn6 A T 6: 104,832,509 I502F probably damaging Het
Crisp4 T C 1: 18,122,794 Y233C probably damaging Het
Ctsb C A 14: 63,139,104 T261N probably benign Het
Ctsk T C 3: 95,500,874 F14L probably benign Het
Dchs1 T C 7: 105,758,178 I2110V probably damaging Het
Dennd5b A G 6: 149,068,490 M155T probably benign Het
Echdc3 T C 2: 6,212,800 D54G probably benign Het
Egln3 G A 12: 54,181,693 T209I probably damaging Het
Fbn1 A C 2: 125,372,527 probably benign Het
Fkbp15 A T 4: 62,304,609 S1018T possibly damaging Het
Flnb T C 14: 7,896,503 I898T probably benign Het
Flt1 T A 5: 147,599,646 Y795F probably damaging Het
Flt4 C T 11: 49,636,339 probably benign Het
Fryl A G 5: 73,064,925 probably benign Het
Fryl T C 5: 73,110,271 E417G probably damaging Het
Gcnt3 T C 9: 70,034,333 I318V probably benign Het
Gm11437 T A 11: 84,164,628 H54L possibly damaging Het
Huwe1 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA X: 151,907,048 probably benign Het
Jarid2 G A 13: 44,884,892 probably benign Het
Kif5b A T 18: 6,214,044 V653E probably benign Het
Kmt2b A G 7: 30,574,940 V2113A probably damaging Het
Knl1 C T 2: 119,072,573 T1585I probably benign Het
Mlxipl T A 5: 135,132,718 M497K probably benign Het
Mre11a T A 9: 14,799,639 W210R probably damaging Het
Mrps22 A G 9: 98,594,695 V207A probably benign Het
Myo15 A G 11: 60,499,430 I2111V possibly damaging Het
Myo1a C T 10: 127,719,279 P838L probably benign Het
Nbea T A 3: 56,058,040 H484L probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nlrp2 T A 7: 5,328,431 D322V probably damaging Het
Nrcam T C 12: 44,590,164 C1057R probably damaging Het
Ntsr1 T C 2: 180,500,601 S62P probably damaging Het
Nudt18 A G 14: 70,579,427 H157R probably benign Het
Olfr1002 T A 2: 85,647,560 T254S probably damaging Het
Olfr982 C A 9: 40,074,896 N200K probably damaging Het
Sidt2 T C 9: 45,945,704 T435A probably damaging Het
Snx27 T C 3: 94,520,233 T312A probably benign Het
Srebf2 T C 15: 82,177,519 S429P probably damaging Het
Suclg2 A G 6: 95,497,582 probably benign Het
Tchh A T 3: 93,444,972 E573V unknown Het
Tdrd1 A G 19: 56,861,760 T985A probably benign Het
Ttn T C 2: 76,795,664 E13271G probably damaging Het
Usp13 A G 3: 32,915,708 E661G probably damaging Het
Vasp T G 7: 19,259,033 probably benign Het
Vmn2r109 A T 17: 20,555,241 Y75N possibly damaging Het
Vmn2r15 T A 5: 109,292,904 N363Y probably damaging Het
Vmn2r60 T A 7: 42,137,052 N426K probably benign Het
Wisp2 T A 2: 163,829,077 M168K unknown Het
Znhit2 C A 19: 6,062,258 N344K probably damaging Het
Other mutations in Ttc7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00740:Ttc7b APN 12 100376213 missense probably benign 0.03
IGL01377:Ttc7b APN 12 100355112 missense probably benign 0.21
IGL01617:Ttc7b APN 12 100385956 missense possibly damaging 0.94
IGL02928:Ttc7b APN 12 100403415 missense probably damaging 1.00
IGL03183:Ttc7b APN 12 100373709 splice site probably null
IGL03341:Ttc7b APN 12 100325735 missense possibly damaging 0.66
R0302:Ttc7b UTSW 12 100387179 missense possibly damaging 0.94
R0620:Ttc7b UTSW 12 100500073 splice site probably null
R0625:Ttc7b UTSW 12 100355046 missense probably benign 0.04
R1016:Ttc7b UTSW 12 100403358 missense probably null 1.00
R1131:Ttc7b UTSW 12 100382119 critical splice donor site probably null
R1710:Ttc7b UTSW 12 100403408 missense probably damaging 0.98
R1803:Ttc7b UTSW 12 100407002 missense possibly damaging 0.94
R1887:Ttc7b UTSW 12 100415130 splice site probably null
R1920:Ttc7b UTSW 12 100415130 splice site probably null
R1921:Ttc7b UTSW 12 100415130 splice site probably null
R1922:Ttc7b UTSW 12 100415130 splice site probably null
R2062:Ttc7b UTSW 12 100325689 missense probably damaging 1.00
R2239:Ttc7b UTSW 12 100355001 critical splice donor site probably null
R2380:Ttc7b UTSW 12 100355001 critical splice donor site probably null
R4581:Ttc7b UTSW 12 100500117 missense probably damaging 0.99
R4582:Ttc7b UTSW 12 100500117 missense probably damaging 0.99
R4598:Ttc7b UTSW 12 100500117 missense probably damaging 0.99
R4599:Ttc7b UTSW 12 100500117 missense probably damaging 0.99
R4600:Ttc7b UTSW 12 100500117 missense probably damaging 0.99
R4601:Ttc7b UTSW 12 100500117 missense probably damaging 0.99
R4779:Ttc7b UTSW 12 100403362 missense probably damaging 1.00
R5027:Ttc7b UTSW 12 100301742 missense probably damaging 1.00
R5244:Ttc7b UTSW 12 100348010 missense probably damaging 0.99
R5387:Ttc7b UTSW 12 100446963 missense possibly damaging 0.64
R5739:Ttc7b UTSW 12 100384233 missense probably damaging 1.00
R5997:Ttc7b UTSW 12 100373560 missense probably damaging 0.96
R6223:Ttc7b UTSW 12 100387109 critical splice donor site probably null
R6238:Ttc7b UTSW 12 100495422 missense probably benign 0.31
R6318:Ttc7b UTSW 12 100325677 missense probably damaging 0.99
R6494:Ttc7b UTSW 12 100495407 missense possibly damaging 0.73
R7153:Ttc7b UTSW 12 100355034 missense probably damaging 1.00
R8084:Ttc7b UTSW 12 100384173 missense probably damaging 1.00
R8132:Ttc7b UTSW 12 100446872 missense probably damaging 0.99
R8364:Ttc7b UTSW 12 100325558 missense probably benign 0.40
R8536:Ttc7b UTSW 12 100373544 missense possibly damaging 0.56
R8719:Ttc7b UTSW 12 100301553 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AACTGCTTAGCCCAGTCACACAGG -3'
(R):5'- CAGGGTCGAGTCAAACAGTAGTGTC -3'

Sequencing Primer
(F):5'- GACATATGCCCCTGGCAGAAG -3'
(R):5'- AGTCAAACAGTAGTGTCTGTCTG -3'
Posted On2014-01-29