Incidental Mutation 'R1241:Nudt18'
ID152021
Institutional Source Beutler Lab
Gene Symbol Nudt18
Ensembl Gene ENSMUSG00000045211
Gene Namenudix (nucleoside diphosphate linked moiety X)-type motif 18
Synonyms
MMRRC Submission 039308-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #R1241 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location70577637-70582688 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70579427 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 157 (H157R)
Ref Sequence ENSEMBL: ENSMUSP00000086450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022690] [ENSMUST00000089049] [ENSMUST00000228554] [ENSMUST00000228768]
Predicted Effect probably benign
Transcript: ENSMUST00000022690
SMART Domains Protein: ENSMUSP00000022690
Gene: ENSMUSG00000022095

DomainStartEndE-ValueType
Pfam:RAI16-like 79 477 7.7e-112 PFAM
low complexity region 516 528 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000089049
AA Change: H157R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000086450
Gene: ENSMUSG00000045211
AA Change: H157R

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:NUDIX 44 165 2.5e-18 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000228554
AA Change: M86V
Predicted Effect probably benign
Transcript: ENSMUST00000228768
AA Change: H99R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0778 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Nudix hydrolase family. Nudix hydrolases eliminate potentially toxic nucleotide metabolites from the cell and regulate the concentrations and availability of many different nucleotide substrates, cofactors, and signaling molecules. This protein contains a Nudix hydrolase domain and hydrolyzes oxidized forms of guanosine and deoxyguanosine diphosphates. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,505 S119N probably benign Het
9030619P08Rik A C 15: 75,429,997 noncoding transcript Het
Aldh1l2 T C 10: 83,496,025 I639V probably benign Het
Ambra1 T C 2: 91,770,896 probably benign Het
Ap5z1 T C 5: 142,470,114 Y299H probably damaging Het
Atp6v1b1 A T 6: 83,756,544 probably benign Het
Atr G A 9: 95,950,636 V2574I probably benign Het
Atxn1l T A 8: 109,732,980 T217S probably benign Het
Ccdc85a A G 11: 28,396,150 S89P probably benign Het
Cd209e A T 8: 3,849,124 I196N probably damaging Het
Cdhr4 A G 9: 107,995,296 S247G probably benign Het
Cntn6 A T 6: 104,832,509 I502F probably damaging Het
Crisp4 T C 1: 18,122,794 Y233C probably damaging Het
Ctsb C A 14: 63,139,104 T261N probably benign Het
Ctsk T C 3: 95,500,874 F14L probably benign Het
Dchs1 T C 7: 105,758,178 I2110V probably damaging Het
Dennd5b A G 6: 149,068,490 M155T probably benign Het
Echdc3 T C 2: 6,212,800 D54G probably benign Het
Egln3 G A 12: 54,181,693 T209I probably damaging Het
Fbn1 A C 2: 125,372,527 probably benign Het
Fkbp15 A T 4: 62,304,609 S1018T possibly damaging Het
Flnb T C 14: 7,896,503 I898T probably benign Het
Flt1 T A 5: 147,599,646 Y795F probably damaging Het
Flt4 C T 11: 49,636,339 probably benign Het
Fryl A G 5: 73,064,925 probably benign Het
Fryl T C 5: 73,110,271 E417G probably damaging Het
Gcnt3 T C 9: 70,034,333 I318V probably benign Het
Gm11437 T A 11: 84,164,628 H54L possibly damaging Het
Huwe1 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA X: 151,907,048 probably benign Het
Jarid2 G A 13: 44,884,892 probably benign Het
Kif5b A T 18: 6,214,044 V653E probably benign Het
Kmt2b A G 7: 30,574,940 V2113A probably damaging Het
Knl1 C T 2: 119,072,573 T1585I probably benign Het
Mlxipl T A 5: 135,132,718 M497K probably benign Het
Mre11a T A 9: 14,799,639 W210R probably damaging Het
Mrps22 A G 9: 98,594,695 V207A probably benign Het
Myo15 A G 11: 60,499,430 I2111V possibly damaging Het
Myo1a C T 10: 127,719,279 P838L probably benign Het
Nbea T A 3: 56,058,040 H484L probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nlrp2 T A 7: 5,328,431 D322V probably damaging Het
Nrcam T C 12: 44,590,164 C1057R probably damaging Het
Ntsr1 T C 2: 180,500,601 S62P probably damaging Het
Olfr1002 T A 2: 85,647,560 T254S probably damaging Het
Olfr982 C A 9: 40,074,896 N200K probably damaging Het
Sidt2 T C 9: 45,945,704 T435A probably damaging Het
Snx27 T C 3: 94,520,233 T312A probably benign Het
Srebf2 T C 15: 82,177,519 S429P probably damaging Het
Suclg2 A G 6: 95,497,582 probably benign Het
Tchh A T 3: 93,444,972 E573V unknown Het
Tdrd1 A G 19: 56,861,760 T985A probably benign Het
Ttc7b A G 12: 100,403,439 I357T possibly damaging Het
Ttn T C 2: 76,795,664 E13271G probably damaging Het
Usp13 A G 3: 32,915,708 E661G probably damaging Het
Vasp T G 7: 19,259,033 probably benign Het
Vmn2r109 A T 17: 20,555,241 Y75N possibly damaging Het
Vmn2r15 T A 5: 109,292,904 N363Y probably damaging Het
Vmn2r60 T A 7: 42,137,052 N426K probably benign Het
Wisp2 T A 2: 163,829,077 M168K unknown Het
Znhit2 C A 19: 6,062,258 N344K probably damaging Het
Other mutations in Nudt18
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1867:Nudt18 UTSW 14 70579895 missense probably damaging 1.00
R2033:Nudt18 UTSW 14 70579616 missense possibly damaging 0.69
R5016:Nudt18 UTSW 14 70579463 missense probably benign 0.28
R6270:Nudt18 UTSW 14 70579390 missense probably benign 0.12
R7078:Nudt18 UTSW 14 70579012 missense possibly damaging 0.50
R7247:Nudt18 UTSW 14 70577982 missense unknown
R7442:Nudt18 UTSW 14 70579358 missense probably benign 0.01
R7448:Nudt18 UTSW 14 70577949 start codon destroyed unknown
R7661:Nudt18 UTSW 14 70579836 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCCATTTACTCTCTCAGGCTCAAC -3'
(R):5'- TGGTCTCCACTGCCAAACTGTG -3'

Sequencing Primer
(F):5'- AGGCTCAACCCTTCTCATACTG -3'
(R):5'- TTGTTCCATAGGGGTAAAGCCAC -3'
Posted On2014-01-29