Incidental Mutation 'R1241:Tdrd1'
ID152027
Institutional Source Beutler Lab
Gene Symbol Tdrd1
Ensembl Gene ENSMUSG00000025081
Gene Nametudor domain containing 1
SynonymsMTR-1
MMRRC Submission 039308-MU
Accession Numbers

Genbank: NM_001002238

Is this an essential gene? Possibly non essential (E-score: 0.409) question?
Stock #R1241 (G1)
Quality Score217
Status Validated
Chromosome19
Chromosomal Location56826209-56870012 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56861760 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 985 (T985A)
Ref Sequence ENSEMBL: ENSMUSP00000112786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078723] [ENSMUST00000111604] [ENSMUST00000111606] [ENSMUST00000121249]
Predicted Effect probably benign
Transcript: ENSMUST00000078723
AA Change: T985A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000077785
Gene: ENSMUSG00000025081
AA Change: T985A

DomainStartEndE-ValueType
low complexity region 75 86 N/A INTRINSIC
low complexity region 103 117 N/A INTRINSIC
Pfam:zf-MYND 163 199 3.5e-13 PFAM
TUDOR 306 365 6.45e-11 SMART
TUDOR 537 593 4.88e-11 SMART
low complexity region 698 714 N/A INTRINSIC
low complexity region 728 739 N/A INTRINSIC
TUDOR 755 813 3.97e-11 SMART
TUDOR 981 1038 1.27e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111604
AA Change: T985A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107231
Gene: ENSMUSG00000025081
AA Change: T985A

DomainStartEndE-ValueType
low complexity region 75 86 N/A INTRINSIC
low complexity region 103 117 N/A INTRINSIC
Pfam:zf-MYND 163 199 3.5e-13 PFAM
TUDOR 306 365 6.45e-11 SMART
TUDOR 537 593 4.88e-11 SMART
low complexity region 698 714 N/A INTRINSIC
low complexity region 728 739 N/A INTRINSIC
TUDOR 755 813 3.97e-11 SMART
TUDOR 981 1038 1.27e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111606
AA Change: T985A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107233
Gene: ENSMUSG00000025081
AA Change: T985A

DomainStartEndE-ValueType
low complexity region 75 86 N/A INTRINSIC
low complexity region 103 117 N/A INTRINSIC
Pfam:zf-MYND 163 199 3.5e-13 PFAM
TUDOR 306 365 6.45e-11 SMART
TUDOR 537 593 4.88e-11 SMART
low complexity region 698 714 N/A INTRINSIC
low complexity region 728 739 N/A INTRINSIC
TUDOR 755 813 3.97e-11 SMART
TUDOR 981 1038 1.27e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121249
AA Change: T985A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112786
Gene: ENSMUSG00000025081
AA Change: T985A

DomainStartEndE-ValueType
low complexity region 75 86 N/A INTRINSIC
low complexity region 103 117 N/A INTRINSIC
Pfam:zf-MYND 163 199 9.9e-13 PFAM
TUDOR 306 365 6.45e-11 SMART
TUDOR 537 593 4.88e-11 SMART
low complexity region 698 714 N/A INTRINSIC
low complexity region 728 739 N/A INTRINSIC
TUDOR 755 813 3.97e-11 SMART
TUDOR 981 1038 1.27e-9 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is similar to a mouse gene that encodes a tudor domain protein. Alternatively spliced transcript variants have been described but their full length sequences have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Male homozygous mice are sterile, displaying postnatal spermatogenic defects. Females are fertile. [provided by MGI curators]
Allele List at MGI

 All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,505 S119N probably benign Het
9030619P08Rik A C 15: 75,429,997 noncoding transcript Het
Aldh1l2 T C 10: 83,496,025 I639V probably benign Het
Ambra1 T C 2: 91,770,896 probably benign Het
Ap5z1 T C 5: 142,470,114 Y299H probably damaging Het
Atp6v1b1 A T 6: 83,756,544 probably benign Het
Atr G A 9: 95,950,636 V2574I probably benign Het
Atxn1l T A 8: 109,732,980 T217S probably benign Het
Ccdc85a A G 11: 28,396,150 S89P probably benign Het
Cd209e A T 8: 3,849,124 I196N probably damaging Het
Cdhr4 A G 9: 107,995,296 S247G probably benign Het
Cntn6 A T 6: 104,832,509 I502F probably damaging Het
Crisp4 T C 1: 18,122,794 Y233C probably damaging Het
Ctsb C A 14: 63,139,104 T261N probably benign Het
Ctsk T C 3: 95,500,874 F14L probably benign Het
Dchs1 T C 7: 105,758,178 I2110V probably damaging Het
Dennd5b A G 6: 149,068,490 M155T probably benign Het
Echdc3 T C 2: 6,212,800 D54G probably benign Het
Egln3 G A 12: 54,181,693 T209I probably damaging Het
Fbn1 A C 2: 125,372,527 probably benign Het
Fkbp15 A T 4: 62,304,609 S1018T possibly damaging Het
Flnb T C 14: 7,896,503 I898T probably benign Het
Flt1 T A 5: 147,599,646 Y795F probably damaging Het
Flt4 C T 11: 49,636,339 probably benign Het
Fryl A G 5: 73,064,925 probably benign Het
Fryl T C 5: 73,110,271 E417G probably damaging Het
Gcnt3 T C 9: 70,034,333 I318V probably benign Het
Gm11437 T A 11: 84,164,628 H54L possibly damaging Het
Huwe1 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA X: 151,907,048 probably benign Het
Jarid2 G A 13: 44,884,892 probably benign Het
Kif5b A T 18: 6,214,044 V653E probably benign Het
Kmt2b A G 7: 30,574,940 V2113A probably damaging Het
Knl1 C T 2: 119,072,573 T1585I probably benign Het
Mlxipl T A 5: 135,132,718 M497K probably benign Het
Mre11a T A 9: 14,799,639 W210R probably damaging Het
Mrps22 A G 9: 98,594,695 V207A probably benign Het
Myo15 A G 11: 60,499,430 I2111V possibly damaging Het
Myo1a C T 10: 127,719,279 P838L probably benign Het
Nbea T A 3: 56,058,040 H484L probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nlrp2 T A 7: 5,328,431 D322V probably damaging Het
Nrcam T C 12: 44,590,164 C1057R probably damaging Het
Ntsr1 T C 2: 180,500,601 S62P probably damaging Het
Nudt18 A G 14: 70,579,427 H157R probably benign Het
Olfr1002 T A 2: 85,647,560 T254S probably damaging Het
Olfr982 C A 9: 40,074,896 N200K probably damaging Het
Sidt2 T C 9: 45,945,704 T435A probably damaging Het
Snx27 T C 3: 94,520,233 T312A probably benign Het
Srebf2 T C 15: 82,177,519 S429P probably damaging Het
Suclg2 A G 6: 95,497,582 probably benign Het
Tchh A T 3: 93,444,972 E573V unknown Het
Ttc7b A G 12: 100,403,439 I357T possibly damaging Het
Ttn T C 2: 76,795,664 E13271G probably damaging Het
Usp13 A G 3: 32,915,708 E661G probably damaging Het
Vasp T G 7: 19,259,033 probably benign Het
Vmn2r109 A T 17: 20,555,241 Y75N possibly damaging Het
Vmn2r15 T A 5: 109,292,904 N363Y probably damaging Het
Vmn2r60 T A 7: 42,137,052 N426K probably benign Het
Wisp2 T A 2: 163,829,077 M168K unknown Het
Znhit2 C A 19: 6,062,258 N344K probably damaging Het
Other mutations in Tdrd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Tdrd1 APN 19 56851464 missense possibly damaging 0.51
IGL01366:Tdrd1 APN 19 56855302 missense probably benign 0.00
IGL01569:Tdrd1 APN 19 56834409 missense probably damaging 1.00
IGL02691:Tdrd1 APN 19 56843852 missense probably damaging 0.99
3-1:Tdrd1 UTSW 19 56861695 missense probably benign
R0081:Tdrd1 UTSW 19 56831271 missense probably benign 0.16
R0139:Tdrd1 UTSW 19 56843198 missense probably benign 0.00
R0254:Tdrd1 UTSW 19 56842566 missense probably benign 0.02
R0686:Tdrd1 UTSW 19 56856051 missense probably damaging 1.00
R0735:Tdrd1 UTSW 19 56865978 nonsense probably null
R0740:Tdrd1 UTSW 19 56839099 missense probably damaging 1.00
R1294:Tdrd1 UTSW 19 56848776 splice site probably null
R1508:Tdrd1 UTSW 19 56851358 missense probably damaging 1.00
R1655:Tdrd1 UTSW 19 56843216 nonsense probably null
R1708:Tdrd1 UTSW 19 56842289 missense probably benign 0.13
R1796:Tdrd1 UTSW 19 56837783 missense probably damaging 0.98
R1840:Tdrd1 UTSW 19 56842312 missense probably damaging 1.00
R2138:Tdrd1 UTSW 19 56842589 missense probably benign 0.30
R2201:Tdrd1 UTSW 19 56858661 missense probably benign 0.14
R2201:Tdrd1 UTSW 19 56858662 missense probably benign 0.00
R2286:Tdrd1 UTSW 19 56839119 missense probably benign 0.05
R2443:Tdrd1 UTSW 19 56841354 missense probably null 0.01
R3001:Tdrd1 UTSW 19 56861750 nonsense probably null
R3002:Tdrd1 UTSW 19 56861750 nonsense probably null
R3418:Tdrd1 UTSW 19 56831231 missense possibly damaging 0.87
R3419:Tdrd1 UTSW 19 56831231 missense possibly damaging 0.87
R3707:Tdrd1 UTSW 19 56865993 missense possibly damaging 0.86
R3978:Tdrd1 UTSW 19 56866634 missense probably benign 0.01
R4077:Tdrd1 UTSW 19 56831073 missense probably benign 0.22
R4083:Tdrd1 UTSW 19 56843230 missense probably benign
R4193:Tdrd1 UTSW 19 56851341 nonsense probably null
R5882:Tdrd1 UTSW 19 56848939 missense probably damaging 1.00
R6073:Tdrd1 UTSW 19 56843223 nonsense probably null
R6223:Tdrd1 UTSW 19 56865850 missense probably damaging 1.00
R6240:Tdrd1 UTSW 19 56841335 missense probably benign 0.00
R6953:Tdrd1 UTSW 19 56831371 missense probably damaging 0.98
R7090:Tdrd1 UTSW 19 56851401 missense probably benign 0.28
R7643:Tdrd1 UTSW 19 56837708 missense probably damaging 1.00
R7793:Tdrd1 UTSW 19 56864377 missense probably damaging 0.99
X0020:Tdrd1 UTSW 19 56856060 missense probably damaging 1.00
X0053:Tdrd1 UTSW 19 56865791 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TCCCAGAGGCTCCTCATAGTTCAAG -3'
(R):5'- TCCATTCCCAGGCAGCTCCTAAAG -3'

Sequencing Primer
(F):5'- AAGGCAACCAGTAGTCTATCTG -3'
(R):5'- CCAGGCAGCTCCTAAAGTATGG -3'
Posted On2014-01-29