Incidental Mutation 'R1242:Xkr4'
ID152029
Institutional Source Beutler Lab
Gene Symbol Xkr4
Ensembl Gene ENSMUSG00000051951
Gene NameX-linked Kx blood group related 4
Synonyms
MMRRC Submission 039309-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1242 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location3205901-3671498 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 3216137 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 610 (D610V)
Ref Sequence ENSEMBL: ENSMUSP00000070648 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070533]
Predicted Effect probably damaging
Transcript: ENSMUST00000070533
AA Change: D610V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000070648
Gene: ENSMUSG00000051951
AA Change: D610V

DomainStartEndE-ValueType
low complexity region 49 99 N/A INTRINSIC
Pfam:XK-related 111 513 2.6e-128 PFAM
low complexity region 573 586 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159265
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162897
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bbs7 A G 3: 36,578,427 F549L probably damaging Het
Cmc2 T C 8: 116,911,198 D4G probably damaging Het
Cnr2 T A 4: 135,916,983 L124Q probably damaging Het
Cobll1 T C 2: 65,151,169 probably null Het
Defb30 A T 14: 63,036,006 Y53N probably damaging Het
Dtnb T A 12: 3,732,627 Y363* probably null Het
Fam170a A G 18: 50,282,139 E284G probably damaging Het
Fam46c A T 3: 100,472,876 L188Q probably damaging Het
Gm16505 T A 13: 3,361,109 noncoding transcript Het
Gtf2h1 T C 7: 46,812,751 probably null Het
Gucy1a1 C T 3: 82,105,953 probably null Het
Hfm1 T A 5: 106,874,901 N945I probably damaging Het
Hpse2 G A 19: 42,966,977 T327I probably benign Het
Il3 T C 11: 54,267,103 I50V probably benign Het
Mgat5b A G 11: 116,978,404 K591R probably benign Het
Nup214 C T 2: 31,977,770 T83I probably benign Het
Olfr1396 A T 11: 49,112,901 V275E possibly damaging Het
Rp1 T A 1: 4,344,962 I1976F probably benign Het
Sardh T A 2: 27,235,563 D313V probably damaging Het
Vmn1r173 C T 7: 23,703,225 P295L probably damaging Het
Vmn1r38 A C 6: 66,776,360 Y257* probably null Het
Other mutations in Xkr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03398:Xkr4 APN 1 3216575 missense probably damaging 1.00
R0200:Xkr4 UTSW 1 3670663 missense probably benign 0.00
R0829:Xkr4 UTSW 1 3671246 missense possibly damaging 0.59
R0830:Xkr4 UTSW 1 3670745 missense possibly damaging 0.48
R0959:Xkr4 UTSW 1 3216674 missense probably damaging 1.00
R1257:Xkr4 UTSW 1 3216813 missense probably benign 0.29
R2002:Xkr4 UTSW 1 3671095 missense probably benign
R3896:Xkr4 UTSW 1 3216191 missense probably damaging 0.99
R4006:Xkr4 UTSW 1 3421775 missense probably benign 0.01
R4173:Xkr4 UTSW 1 3216488 missense probably damaging 1.00
R4770:Xkr4 UTSW 1 3216491 missense probably damaging 1.00
R4868:Xkr4 UTSW 1 3216851 missense probably damaging 1.00
R5103:Xkr4 UTSW 1 3670688 missense probably benign
R5548:Xkr4 UTSW 1 3216930 missense probably damaging 1.00
R5602:Xkr4 UTSW 1 3216528 missense probably benign 0.18
R5608:Xkr4 UTSW 1 3671380 start gained probably benign
R5668:Xkr4 UTSW 1 3671035 missense probably damaging 1.00
R5901:Xkr4 UTSW 1 3216678 missense probably damaging 0.99
R6296:Xkr4 UTSW 1 3216570 missense probably benign 0.01
R6302:Xkr4 UTSW 1 3216738 missense probably damaging 0.99
R6326:Xkr4 UTSW 1 3671038 missense possibly damaging 0.75
R6341:Xkr4 UTSW 1 3670778 missense probably benign
R6911:Xkr4 UTSW 1 3671321 missense possibly damaging 0.91
R7086:Xkr4 UTSW 1 3216962 missense probably damaging 1.00
R7249:Xkr4 UTSW 1 3216810 missense probably damaging 1.00
R7571:Xkr4 UTSW 1 3670688 missense probably benign 0.00
R7881:Xkr4 UTSW 1 3216264 missense probably damaging 1.00
R7952:Xkr4 UTSW 1 3670619 missense possibly damaging 0.94
R8332:Xkr4 UTSW 1 3421899 missense probably damaging 1.00
Z1176:Xkr4 UTSW 1 3670981 missense probably damaging 1.00
Z1176:Xkr4 UTSW 1 3670982 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTGTCATTATTGCCACAGCCC -3'
(R):5'- TCTGCCTCCAGAAGTAGCCACAAG -3'

Sequencing Primer
(F):5'- CACAGCCCTGCTGTTACC -3'
(R):5'- GCACACTACGGTCCATCTC -3'
Posted On2014-01-29