Incidental Mutation 'R1242:Fam46c'
ID152036
Institutional Source Beutler Lab
Gene Symbol Fam46c
Ensembl Gene ENSMUSG00000044468
Gene Namefamily with sequence similarity 46, member C
Synonyms4930431B09Rik
MMRRC Submission 039309-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1242 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location100451628-100489324 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 100472876 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 188 (L188Q)
Ref Sequence ENSEMBL: ENSMUSP00000056872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061455]
Predicted Effect probably damaging
Transcript: ENSMUST00000061455
AA Change: L188Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056872
Gene: ENSMUSG00000044468
AA Change: L188Q

DomainStartEndE-ValueType
DUF1693 17 336 3.33e-241 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128107
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139833
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypochromic microcytic anemia and decreased B cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bbs7 A G 3: 36,578,427 F549L probably damaging Het
Cmc2 T C 8: 116,911,198 D4G probably damaging Het
Cnr2 T A 4: 135,916,983 L124Q probably damaging Het
Cobll1 T C 2: 65,151,169 probably null Het
Defb30 A T 14: 63,036,006 Y53N probably damaging Het
Dtnb T A 12: 3,732,627 Y363* probably null Het
Fam170a A G 18: 50,282,139 E284G probably damaging Het
Gm16505 T A 13: 3,361,109 noncoding transcript Het
Gtf2h1 T C 7: 46,812,751 probably null Het
Gucy1a1 C T 3: 82,105,953 probably null Het
Hfm1 T A 5: 106,874,901 N945I probably damaging Het
Hpse2 G A 19: 42,966,977 T327I probably benign Het
Il3 T C 11: 54,267,103 I50V probably benign Het
Mgat5b A G 11: 116,978,404 K591R probably benign Het
Nup214 C T 2: 31,977,770 T83I probably benign Het
Olfr1396 A T 11: 49,112,901 V275E possibly damaging Het
Rp1 T A 1: 4,344,962 I1976F probably benign Het
Sardh T A 2: 27,235,563 D313V probably damaging Het
Vmn1r173 C T 7: 23,703,225 P295L probably damaging Het
Vmn1r38 A C 6: 66,776,360 Y257* probably null Het
Xkr4 T A 1: 3,216,137 D610V probably damaging Het
Other mutations in Fam46c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Fam46c APN 3 100473356 missense probably damaging 0.96
IGL01314:Fam46c APN 3 100473174 missense probably benign 0.18
IGL01409:Fam46c APN 3 100473169 missense probably damaging 1.00
IGL01817:Fam46c APN 3 100472855 missense probably damaging 1.00
IGL01863:Fam46c APN 3 100472664 missense probably benign 0.05
IGL01992:Fam46c APN 3 100472630 missense probably damaging 1.00
IGL02436:Fam46c APN 3 100472507 missense probably benign 0.43
R0111:Fam46c UTSW 3 100472786 missense probably damaging 1.00
R0529:Fam46c UTSW 3 100472370 missense probably benign 0.36
R1196:Fam46c UTSW 3 100473000 missense possibly damaging 0.73
R4671:Fam46c UTSW 3 100473199 missense probably benign 0.44
R5252:Fam46c UTSW 3 100472708 missense probably damaging 1.00
R6730:Fam46c UTSW 3 100472957 missense probably benign 0.07
R8205:Fam46c UTSW 3 100472822 missense probably benign 0.04
R8282:Fam46c UTSW 3 100473011 missense probably damaging 1.00
R8483:Fam46c UTSW 3 100472468 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAGGTAGGTCTCCAGCTTCCTC -3'
(R):5'- GCGTGAATAAGCTCAAAATCAGCCC -3'

Sequencing Primer
(F):5'- GTTGCTGTACTTAAGGAGACCCC -3'
(R):5'- CCGTCACCCTGAAGGAGG -3'
Posted On2014-01-29