Incidental Mutation 'R1242:Vmn1r38'
ID152039
Institutional Source Beutler Lab
Gene Symbol Vmn1r38
Ensembl Gene ENSMUSG00000115170
Gene Namevomeronasal 1 receptor 38
SynonymsV1rc13
MMRRC Submission 039309-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.198) question?
Stock #R1242 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location66774003-66782627 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to C at 66776360 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 257 (Y257*)
Ref Sequence ENSEMBL: ENSMUSP00000154495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000176121] [ENSMUST00000226457] [ENSMUST00000227493] [ENSMUST00000227694]
Predicted Effect probably null
Transcript: ENSMUST00000176121
AA Change: Y257*
SMART Domains Protein: ENSMUSP00000135117
Gene: ENSMUSG00000093632
AA Change: Y257*

DomainStartEndE-ValueType
Pfam:V1R 28 293 3.7e-53 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000226457
AA Change: Y257*
Predicted Effect probably null
Transcript: ENSMUST00000227493
AA Change: Y257*
Predicted Effect probably null
Transcript: ENSMUST00000227694
AA Change: Y257*
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bbs7 A G 3: 36,578,427 F549L probably damaging Het
Cmc2 T C 8: 116,911,198 D4G probably damaging Het
Cnr2 T A 4: 135,916,983 L124Q probably damaging Het
Cobll1 T C 2: 65,151,169 probably null Het
Defb30 A T 14: 63,036,006 Y53N probably damaging Het
Dtnb T A 12: 3,732,627 Y363* probably null Het
Fam170a A G 18: 50,282,139 E284G probably damaging Het
Fam46c A T 3: 100,472,876 L188Q probably damaging Het
Gm16505 T A 13: 3,361,109 noncoding transcript Het
Gtf2h1 T C 7: 46,812,751 probably null Het
Gucy1a1 C T 3: 82,105,953 probably null Het
Hfm1 T A 5: 106,874,901 N945I probably damaging Het
Hpse2 G A 19: 42,966,977 T327I probably benign Het
Il3 T C 11: 54,267,103 I50V probably benign Het
Mgat5b A G 11: 116,978,404 K591R probably benign Het
Nup214 C T 2: 31,977,770 T83I probably benign Het
Olfr1396 A T 11: 49,112,901 V275E possibly damaging Het
Rp1 T A 1: 4,344,962 I1976F probably benign Het
Sardh T A 2: 27,235,563 D313V probably damaging Het
Vmn1r173 C T 7: 23,703,225 P295L probably damaging Het
Xkr4 T A 1: 3,216,137 D610V probably damaging Het
Other mutations in Vmn1r38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01892:Vmn1r38 APN 6 66776376 missense probably benign 0.00
IGL02471:Vmn1r38 APN 6 66776767 missense probably benign 0.06
R0483:Vmn1r38 UTSW 6 66776995 missense probably benign 0.10
R0890:Vmn1r38 UTSW 6 66776530 missense probably benign 0.01
R1557:Vmn1r38 UTSW 6 66776386 missense probably benign 0.01
R2266:Vmn1r38 UTSW 6 66776449 missense probably benign 0.02
R2320:Vmn1r38 UTSW 6 66776550 missense possibly damaging 0.94
R2568:Vmn1r38 UTSW 6 66776971 missense probably benign 0.00
R3104:Vmn1r38 UTSW 6 66776446 missense probably benign 0.31
R3552:Vmn1r38 UTSW 6 66776493 missense possibly damaging 0.95
R3792:Vmn1r38 UTSW 6 66776907 missense probably benign 0.01
R4061:Vmn1r38 UTSW 6 66776848 missense possibly damaging 0.87
R4532:Vmn1r38 UTSW 6 66777032 missense probably benign 0.38
R5299:Vmn1r38 UTSW 6 66776698 missense probably benign 0.06
R7173:Vmn1r38 UTSW 6 66776294 missense possibly damaging 0.88
X0022:Vmn1r38 UTSW 6 66777067 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGCGGAGGCAGGgggataaaa -3'
(R):5'- GCAATGCAAGCATCTTCATAGCGAC -3'

Sequencing Primer
(F):5'- gacagtaagcatctccccc -3'
(R):5'- TTCATAGCGACAGCCACTTG -3'
Posted On2014-01-29