Incidental Mutation 'R1242:Mgat5b'
ID152046
Institutional Source Beutler Lab
Gene Symbol Mgat5b
Ensembl Gene ENSMUSG00000043857
Gene Namemannoside acetylglucosaminyltransferase 5, isoenzyme B
SynonymsGnT-IX
MMRRC Submission 039309-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R1242 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location116918863-116986948 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116978404 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 591 (K591R)
Ref Sequence ENSEMBL: ENSMUSP00000099316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103027]
Predicted Effect probably benign
Transcript: ENSMUST00000103027
AA Change: K591R

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000099316
Gene: ENSMUSG00000043857
AA Change: K591R

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Glyco_transf_18 184 777 3.5e-269 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126757
Predicted Effect probably benign
Transcript: ENSMUST00000136584
SMART Domains Protein: ENSMUSP00000122276
Gene: ENSMUSG00000043857

DomainStartEndE-ValueType
Pfam:Glyco_transf_18 1 214 3e-116 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139905
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The MGAT5B gene encodes a beta-1,6-N-acetylglucosaminyltransferase (EC 2.4.1.155) that functions in the synthesis of complex cell surface N-glycans (Kaneko et al., 2003 [PubMed 14623122]).[supplied by OMIM, Nov 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit low levels of O-man-linked beta1,6-branched glycans. Mice homozygous for a different knock-out allele exhibit decreased susceptibility to cuprizone induced injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bbs7 A G 3: 36,578,427 F549L probably damaging Het
Cmc2 T C 8: 116,911,198 D4G probably damaging Het
Cnr2 T A 4: 135,916,983 L124Q probably damaging Het
Cobll1 T C 2: 65,151,169 probably null Het
Defb30 A T 14: 63,036,006 Y53N probably damaging Het
Dtnb T A 12: 3,732,627 Y363* probably null Het
Fam170a A G 18: 50,282,139 E284G probably damaging Het
Fam46c A T 3: 100,472,876 L188Q probably damaging Het
Gm16505 T A 13: 3,361,109 noncoding transcript Het
Gtf2h1 T C 7: 46,812,751 probably null Het
Gucy1a1 C T 3: 82,105,953 probably null Het
Hfm1 T A 5: 106,874,901 N945I probably damaging Het
Hpse2 G A 19: 42,966,977 T327I probably benign Het
Il3 T C 11: 54,267,103 I50V probably benign Het
Nup214 C T 2: 31,977,770 T83I probably benign Het
Olfr1396 A T 11: 49,112,901 V275E possibly damaging Het
Rp1 T A 1: 4,344,962 I1976F probably benign Het
Sardh T A 2: 27,235,563 D313V probably damaging Het
Vmn1r173 C T 7: 23,703,225 P295L probably damaging Het
Vmn1r38 A C 6: 66,776,360 Y257* probably null Het
Xkr4 T A 1: 3,216,137 D610V probably damaging Het
Other mutations in Mgat5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Mgat5b APN 11 116931662 missense probably damaging 0.99
IGL01315:Mgat5b APN 11 116923389 missense probably damaging 1.00
IGL01432:Mgat5b APN 11 116973376 missense probably benign
IGL01480:Mgat5b APN 11 116978452 missense probably benign 0.00
IGL02573:Mgat5b APN 11 116977714 missense probably benign 0.01
IGL02627:Mgat5b APN 11 116983616 missense probably damaging 1.00
IGL03053:Mgat5b APN 11 116923450 missense possibly damaging 0.94
R0149:Mgat5b UTSW 11 116985139 splice site probably benign
R1175:Mgat5b UTSW 11 116977796 missense probably damaging 1.00
R1341:Mgat5b UTSW 11 116978397 missense probably benign 0.38
R1666:Mgat5b UTSW 11 116983648 missense probably benign 0.01
R1667:Mgat5b UTSW 11 116947377 missense probably benign 0.00
R1668:Mgat5b UTSW 11 116983648 missense probably benign 0.01
R1702:Mgat5b UTSW 11 116948659 missense possibly damaging 0.73
R1828:Mgat5b UTSW 11 116977788 missense probably damaging 1.00
R2019:Mgat5b UTSW 11 116947348 missense probably benign 0.07
R2102:Mgat5b UTSW 11 116919429 start gained probably benign
R2382:Mgat5b UTSW 11 116919496 missense probably damaging 0.99
R4995:Mgat5b UTSW 11 116974199 critical splice donor site probably null
R5028:Mgat5b UTSW 11 116985029 missense probably damaging 1.00
R5174:Mgat5b UTSW 11 116977715 missense probably benign 0.01
R5403:Mgat5b UTSW 11 116948657 missense probably benign 0.35
R5643:Mgat5b UTSW 11 116973400 missense probably damaging 0.99
R5644:Mgat5b UTSW 11 116973400 missense probably damaging 0.99
R7116:Mgat5b UTSW 11 116944959 missense possibly damaging 0.93
R7238:Mgat5b UTSW 11 116984983 missense probably benign 0.09
R7284:Mgat5b UTSW 11 116944920 missense probably damaging 0.96
R7440:Mgat5b UTSW 11 116968445 nonsense probably null
R7721:Mgat5b UTSW 11 116966801 missense
R8179:Mgat5b UTSW 11 116931728 missense probably benign 0.01
R8229:Mgat5b UTSW 11 116947387 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- GCCAATGGCTGCATCTTCCTACAG -3'
(R):5'- ACAGTATGACGGGTCAGAGTCTCAC -3'

Sequencing Primer
(F):5'- TCAACCACGAGTTCTTCCG -3'
(R):5'- CCTGGGTGACCCACACTATG -3'
Posted On2014-01-29