Incidental Mutation 'R1244:Heatr3'
ID152092
Institutional Source Beutler Lab
Gene Symbol Heatr3
Ensembl Gene ENSMUSG00000031657
Gene NameHEAT repeat containing 3
SynonymsC030036P15Rik
MMRRC Submission 039311-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.937) question?
Stock #R1244 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location88137855-88172027 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88141739 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 39 (E39G)
Ref Sequence ENSEMBL: ENSMUSP00000112812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034079] [ENSMUST00000121949]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034079
AA Change: E156G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000034079
Gene: ENSMUSG00000031657
AA Change: E156G

DomainStartEndE-ValueType
Pfam:HEAT_EZ 41 106 2.5e-11 PFAM
Blast:ARM 111 171 2e-25 BLAST
Blast:ARM 172 215 1e-15 BLAST
low complexity region 357 366 N/A INTRINSIC
low complexity region 375 393 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000069786
Predicted Effect possibly damaging
Transcript: ENSMUST00000121949
AA Change: E39G

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112812
Gene: ENSMUSG00000031657
AA Change: E39G

DomainStartEndE-ValueType
Blast:ARM 1 54 7e-20 BLAST
Blast:ARM 55 98 8e-16 BLAST
low complexity region 240 249 N/A INTRINSIC
low complexity region 258 276 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184847
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene plays a role in ribosomal protein transport and in the assembly of the 5S ribonucleoprotein particle (5S RNP). The encoded protein also may be involved in NOD2-mediated NF-kappaB signaling. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik C T 12: 71,216,144 T1417I probably benign Het
Abca14 G A 7: 120,216,338 A270T probably benign Het
Ash2l T C 8: 25,817,421 S529G probably damaging Het
Atp13a3 T C 16: 30,361,836 Y125C probably benign Het
Btbd11 C A 10: 85,387,363 T12K unknown Het
Calca A G 7: 114,633,727 Y96H probably damaging Het
Cct4 A G 11: 22,996,417 E131G probably benign Het
Cd84 A G 1: 171,851,830 D25G probably damaging Het
Chd9 A G 8: 91,022,929 D1728G probably damaging Het
Cyp39a1 A T 17: 43,749,945 K461N probably benign Het
Ddx50 T A 10: 62,642,924 Q161L probably damaging Het
Golga5 A G 12: 102,472,295 T90A probably benign Het
Hipk3 G A 2: 104,433,256 R905W probably damaging Het
Hsd11b1 T G 1: 193,223,760 M175L probably benign Het
Htra1 G A 7: 130,985,069 V461I possibly damaging Het
Il10 A G 1: 131,024,216 D162G probably damaging Het
Mapre2 A G 18: 23,853,717 K62R probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Ogfod1 A G 8: 94,037,371 D28G probably benign Het
Olfr1436 A T 19: 12,298,496 I212N probably damaging Het
Perm1 C T 4: 156,217,883 R295C probably benign Het
Ppp4c A G 7: 126,786,280 V119A probably damaging Het
Scn2a T C 2: 65,763,655 I1616T probably damaging Het
Sipa1l1 A G 12: 82,425,416 N1390S probably benign Het
Sub1 A T 15: 11,991,044 V37E possibly damaging Het
Tbc1d17 A T 7: 44,844,398 V267E probably damaging Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Vmn1r77 A T 7: 12,041,920 T140S possibly damaging Het
Vmn2r15 A T 5: 109,293,226 Y255* probably null Het
Other mutations in Heatr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Heatr3 APN 8 88141739 missense possibly damaging 0.95
IGL00780:Heatr3 APN 8 88170940 missense probably benign 0.01
IGL01105:Heatr3 APN 8 88161893 missense probably benign 0.04
IGL01653:Heatr3 APN 8 88144617 missense probably benign
IGL02129:Heatr3 APN 8 88158271 splice site probably benign
IGL02145:Heatr3 APN 8 88144599 missense probably benign 0.40
IGL02177:Heatr3 APN 8 88156723 missense probably benign
IGL02309:Heatr3 APN 8 88167072 missense probably damaging 1.00
IGL02675:Heatr3 APN 8 88144557 missense possibly damaging 0.91
IGL03379:Heatr3 APN 8 88150110 missense probably benign 0.13
R0763:Heatr3 UTSW 8 88158241 missense probably damaging 1.00
R1883:Heatr3 UTSW 8 88144593 missense possibly damaging 0.95
R1988:Heatr3 UTSW 8 88150317 missense probably benign 0.02
R2043:Heatr3 UTSW 8 88147694 splice site probably benign
R2079:Heatr3 UTSW 8 88141776 missense probably damaging 0.99
R2402:Heatr3 UTSW 8 88144572 missense probably benign 0.33
R3916:Heatr3 UTSW 8 88150371 critical splice donor site probably null
R3917:Heatr3 UTSW 8 88150371 critical splice donor site probably null
R4127:Heatr3 UTSW 8 88138311 missense probably damaging 0.99
R4182:Heatr3 UTSW 8 88171002 utr 3 prime probably benign
R4190:Heatr3 UTSW 8 88138260 unclassified probably benign
R4769:Heatr3 UTSW 8 88141783 critical splice donor site probably null
R6046:Heatr3 UTSW 8 88139954 missense probably damaging 1.00
R6073:Heatr3 UTSW 8 88138140 missense probably benign 0.01
R6888:Heatr3 UTSW 8 88170884 missense probably damaging 1.00
R7284:Heatr3 UTSW 8 88156774 missense possibly damaging 0.69
RF025:Heatr3 UTSW 8 88156456 critical splice acceptor site probably benign
RF031:Heatr3 UTSW 8 88156457 critical splice acceptor site probably benign
RF033:Heatr3 UTSW 8 88156456 critical splice acceptor site probably benign
RF040:Heatr3 UTSW 8 88156457 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- ATGCCCAAGGGATGGACCATGTAG -3'
(R):5'- GGAAGAGAAGCAGCCTTGTTCCTC -3'

Sequencing Primer
(F):5'- ACCATGTAGAGAACTGTACCTG -3'
(R):5'- ATCAGCCAATGTTCGTGGTC -3'
Posted On2014-01-29