Incidental Mutation 'R1244:Cyp39a1'
ID152105
Institutional Source Beutler Lab
Gene Symbol Cyp39a1
Ensembl Gene ENSMUSG00000023963
Gene Namecytochrome P450, family 39, subfamily a, polypeptide 1
Synonymsoxysterol 7-alpha-hydroxylase
MMRRC Submission 039311-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R1244 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location43667425-43751431 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 43749945 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 461 (K461N)
Ref Sequence ENSEMBL: ENSMUSP00000130073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170988]
Predicted Effect probably benign
Transcript: ENSMUST00000170988
AA Change: K461N

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000130073
Gene: ENSMUSG00000023963
AA Change: K461N

DomainStartEndE-ValueType
Pfam:p450 32 464 1.9e-52 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic reticulum protein is involved in the conversion of cholesterol to bile acids. Its substrates include the oxysterols 25-hydroxycholesterol, 27-hydroxycholesterol and 24-hydroxycholesterol. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik C T 12: 71,216,144 T1417I probably benign Het
Abca14 G A 7: 120,216,338 A270T probably benign Het
Ash2l T C 8: 25,817,421 S529G probably damaging Het
Atp13a3 T C 16: 30,361,836 Y125C probably benign Het
Btbd11 C A 10: 85,387,363 T12K unknown Het
Calca A G 7: 114,633,727 Y96H probably damaging Het
Cct4 A G 11: 22,996,417 E131G probably benign Het
Cd84 A G 1: 171,851,830 D25G probably damaging Het
Chd9 A G 8: 91,022,929 D1728G probably damaging Het
Ddx50 T A 10: 62,642,924 Q161L probably damaging Het
Golga5 A G 12: 102,472,295 T90A probably benign Het
Heatr3 A G 8: 88,141,739 E39G possibly damaging Het
Hipk3 G A 2: 104,433,256 R905W probably damaging Het
Hsd11b1 T G 1: 193,223,760 M175L probably benign Het
Htra1 G A 7: 130,985,069 V461I possibly damaging Het
Il10 A G 1: 131,024,216 D162G probably damaging Het
Mapre2 A G 18: 23,853,717 K62R probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Ogfod1 A G 8: 94,037,371 D28G probably benign Het
Olfr1436 A T 19: 12,298,496 I212N probably damaging Het
Perm1 C T 4: 156,217,883 R295C probably benign Het
Ppp4c A G 7: 126,786,280 V119A probably damaging Het
Scn2a T C 2: 65,763,655 I1616T probably damaging Het
Sipa1l1 A G 12: 82,425,416 N1390S probably benign Het
Sub1 A T 15: 11,991,044 V37E possibly damaging Het
Tbc1d17 A T 7: 44,844,398 V267E probably damaging Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Vmn1r77 A T 7: 12,041,920 T140S possibly damaging Het
Vmn2r15 A T 5: 109,293,226 Y255* probably null Het
Other mutations in Cyp39a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Cyp39a1 APN 17 43701543 missense probably benign 0.01
IGL01070:Cyp39a1 APN 17 43683022 missense probably benign 0.00
IGL01606:Cyp39a1 APN 17 43746618 splice site probably benign
IGL01769:Cyp39a1 APN 17 43749915 missense possibly damaging 0.53
IGL01916:Cyp39a1 APN 17 43731050 missense probably damaging 1.00
IGL02374:Cyp39a1 APN 17 43749981 utr 3 prime probably benign
IGL02402:Cyp39a1 APN 17 43691722 missense probably benign 0.07
IGL03097:Cyp39a1 UTSW 17 43683050 nonsense probably null
R0230:Cyp39a1 UTSW 17 43732012 missense probably damaging 1.00
R1572:Cyp39a1 UTSW 17 43680129 missense probably damaging 1.00
R1656:Cyp39a1 UTSW 17 43667619 missense possibly damaging 0.74
R4036:Cyp39a1 UTSW 17 43676940 missense probably damaging 0.97
R4308:Cyp39a1 UTSW 17 43730964 splice site probably null
R5081:Cyp39a1 UTSW 17 43746597 missense probably damaging 1.00
R5197:Cyp39a1 UTSW 17 43746538 missense possibly damaging 0.67
R5405:Cyp39a1 UTSW 17 43676940 missense probably damaging 1.00
R5566:Cyp39a1 UTSW 17 43685208 missense possibly damaging 0.92
R5578:Cyp39a1 UTSW 17 43680140 missense possibly damaging 0.91
R6045:Cyp39a1 UTSW 17 43731991 missense probably damaging 1.00
R6495:Cyp39a1 UTSW 17 43691694 missense probably benign 0.41
R7191:Cyp39a1 UTSW 17 43731019 nonsense probably null
R7431:Cyp39a1 UTSW 17 43683015 missense probably benign
R7522:Cyp39a1 UTSW 17 43667479 start gained probably benign
R7620:Cyp39a1 UTSW 17 43725653 splice site probably null
R8022:Cyp39a1 UTSW 17 43746577 missense probably damaging 1.00
R8143:Cyp39a1 UTSW 17 43725626 missense probably benign 0.39
Z1176:Cyp39a1 UTSW 17 43725577 missense probably benign 0.01
Z1176:Cyp39a1 UTSW 17 43731048 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAGCAGGCAAACCTGTAAGC -3'
(R):5'- AGCGGTTGGCATCAATAAGCCTAAG -3'

Sequencing Primer
(F):5'- CTCCTCAAATGGTAAAGTGGATGC -3'
(R):5'- GGCTATGTATGAAGCCAAATTCC -3'
Posted On2014-01-29