Incidental Mutation 'R1245:Nmnat2'
ID152111
Institutional Source Beutler Lab
Gene Symbol Nmnat2
Ensembl Gene ENSMUSG00000042751
Gene Namenicotinamide nucleotide adenylyltransferase 2
SynonymsPNAT1, D030041I09Rik
MMRRC Submission 039312-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1245 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location152954993-153119261 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 153112203 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 238 (D238G)
Ref Sequence ENSEMBL: ENSMUSP00000041110 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043313] [ENSMUST00000186368]
Predicted Effect probably benign
Transcript: ENSMUST00000043313
AA Change: D238G

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000041110
Gene: ENSMUSG00000042751
AA Change: D238G

DomainStartEndE-ValueType
Pfam:CTP_transf_like 12 276 2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186368
AA Change: D238G

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000140585
Gene: ENSMUSG00000042751
AA Change: D238G

DomainStartEndE-ValueType
Pfam:CTP_transf_2 12 275 2e-32 PFAM
Meta Mutation Damage Score 0.0655 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the nicotinamide mononucleotide adenylyltransferase (NMNAT) enzyme family, members of which catalyze an essential step in NAD (NADP) biosynthetic pathway. Unlike the other human family member, which is localized to the nucleus, and is ubiquitously expressed; this enzyme is cytoplasmic, and is predominantly expressed in the brain. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap or transposon inserted allele exhibit perinatal lethality, distended bladders, atelectasis and loss of axon integrity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 T A 11: 7,169,410 probably benign Het
Ahnak A G 19: 9,004,169 N939S probably benign Het
Cblb C A 16: 52,047,187 probably benign Het
Cd22 A G 7: 30,869,883 S603P probably damaging Het
Col6a6 G A 9: 105,748,910 R1515C possibly damaging Het
Csf1r C A 18: 61,114,812 D317E probably benign Het
Dlg2 T C 7: 92,442,595 probably benign Het
Enpp3 G A 10: 24,784,953 probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gm5828 A T 1: 16,769,129 noncoding transcript Het
Gpr137c T C 14: 45,279,065 probably benign Het
Ibtk A G 9: 85,720,742 probably null Het
Kctd7 A G 5: 130,148,217 H96R possibly damaging Het
Lmcd1 T A 6: 112,315,712 V175E probably benign Het
Lrfn2 A T 17: 49,096,249 probably null Het
Ltbp1 C T 17: 75,327,194 probably benign Het
Myc A G 15: 61,987,897 I140V probably damaging Het
Nckap1l A G 15: 103,455,925 E100G probably damaging Het
Ncs1 A G 2: 31,284,693 N143S probably benign Het
Olfr1122 T A 2: 87,388,209 V168E probably benign Het
Ppp2r3a G A 9: 101,194,394 T675I probably damaging Het
Psma2 A G 13: 14,613,291 Y6C probably damaging Het
Rspo4 G A 2: 151,867,926 E84K probably damaging Het
Shank2 G A 7: 144,411,720 V1015I probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Smg8 T C 11: 87,083,610 D632G possibly damaging Het
Sppl2a A T 2: 126,913,521 probably benign Het
Svep1 A G 4: 58,066,427 probably null Het
Ttn T A 2: 76,945,700 K1666M probably damaging Het
Ulk1 A G 5: 110,789,340 probably null Het
Unc80 A G 1: 66,555,095 D1211G possibly damaging Het
Vmn2r112 A G 17: 22,603,247 Q302R probably benign Het
Vmn2r6 A G 3: 64,556,790 S208P possibly damaging Het
Wnk1 C T 6: 119,948,457 V1847I probably benign Het
Zfp653 A T 9: 22,056,422 I529N probably damaging Het
Zfp948 T C 17: 21,586,842 S99P probably damaging Het
Zfyve9 A G 4: 108,693,311 probably benign Het
Zscan29 T C 2: 121,166,503 T246A probably damaging Het
Other mutations in Nmnat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Nmnat2 APN 1 153094117 splice site probably null
IGL01447:Nmnat2 APN 1 153112443 missense possibly damaging 0.50
IGL01686:Nmnat2 APN 1 153076997 splice site probably benign
IGL01916:Nmnat2 APN 1 153094046 missense probably damaging 0.99
R0309:Nmnat2 UTSW 1 153077001 splice site probably benign
R1475:Nmnat2 UTSW 1 153074695 missense probably damaging 1.00
R1780:Nmnat2 UTSW 1 153112440 nonsense probably null
R2860:Nmnat2 UTSW 1 153112425 missense probably benign
R2861:Nmnat2 UTSW 1 153112425 missense probably benign
R2862:Nmnat2 UTSW 1 153112425 missense probably benign
R2939:Nmnat2 UTSW 1 153074728 missense probably damaging 1.00
R5590:Nmnat2 UTSW 1 153094061 missense probably damaging 1.00
R6056:Nmnat2 UTSW 1 153074734 nonsense probably null
R6267:Nmnat2 UTSW 1 153076971 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCTGTGAGGGCTGAGGTAAACG -3'
(R):5'- TGGAGCTGACTACAGACATGGGATG -3'

Sequencing Primer
(F):5'- ctaagcgtcctctgtgcc -3'
(R):5'- CACAACCATGATGTTGTTCTGG -3'
Posted On2014-01-29