Mutagenetix > Incidental Mutation

Incidental Mutation 'R1245:Myc'

152138

Institutional Source

Beutler Lab

Gene Symbol

Myc

Ensembl Gene

ENSMUSG00000022346

Gene Name

myelocytomatosis oncogene

Synonyms

Niard, Myc2, bHLHe39, Nird, c-myc

MMRRC Submission

039312-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1245 (G1)

Quality Score

134

Status

Validated

Chromosome

Chromosomal Location

61857240-61862223 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 61859746 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 140 (I140V)

Ref Sequence

ENSEMBL: ENSMUSP00000141139 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022971] [ENSMUST00000159327] [ENSMUST00000159338] [ENSMUST00000160009] [ENSMUST00000161976] [ENSMUST00000167731] [ENSMUST00000188482] [ENSMUST00000191178]

AlphaFold

P01108

Predicted Effect

probably damaging
Transcript: ENSMUST00000022971
AA Change: I141V

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000022971
Gene: ENSMUSG00000022346
AA Change: I141V

Domain	Start	End	E-Value	Type
Pfam:Myc_N	16	360	7e-118	PFAM
HLH	375	427	2.3e-14	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000159327
AA Change: I126V

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000124758
Gene: ENSMUSG00000022346
AA Change: I126V

Domain	Start	End	E-Value	Type
Pfam:Myc_N	1	345	1.4e-141	PFAM
HLH	360	412	2.3e-14	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000159338

Predicted Effect

possibly damaging
Transcript: ENSMUST00000160009
AA Change: I126V

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000123852
Gene: ENSMUSG00000022346
AA Change: I126V

Domain	Start	End	E-Value	Type
Pfam:Myc_N	1	345	1.4e-141	PFAM
HLH	360	412	2.3e-14	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000161976
AA Change: I126V

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000123821
Gene: ENSMUSG00000022346
AA Change: I126V

Domain	Start	End	E-Value	Type
Pfam:Myc_N	1	345	1.4e-141	PFAM
HLH	360	412	2.3e-14	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000167731
AA Change: I140V

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000130285
Gene: ENSMUSG00000022346
AA Change: I140V

Domain	Start	End	E-Value	Type
Pfam:Myc_N	15	359	1.5e-141	PFAM
HLH	374	426	2.3e-14	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000188482
AA Change: I141V

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000140183
Gene: ENSMUSG00000022346
AA Change: I141V

Domain	Start	End	E-Value	Type
Pfam:Myc_N	16	360	1.5e-141	PFAM
HLH	375	427	2.3e-14	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000191178
AA Change: I140V

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000141139
Gene: ENSMUSG00000022346
AA Change: I140V

Domain	Start	End	E-Value	Type
Pfam:Myc_N	15	359	1.9e-141	PFAM
HLH	374	426	2.3e-14	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192740

Meta Mutation Damage Score

0.1088

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.9%
20x: 91.5%

Validation Efficiency

98% (41/42)

MGI Phenotype

FUNCTION: The protein encoded by this gene is a multifunctional, nuclear phosphoprotein that plays a role in cell cycle progression, apoptosis and cellular transformation. It functions as a transcription factor that regulates transcription of specific target genes. Mutations, overexpression, rearrangement and translocation of this gene have been associated with a variety of hematopoietic tumors, leukemias and lymphomas, including Burkitt lymphoma, in human. There is evidence to show that alternative translation initiations from an upstream, in-frame non-AUG (CUG) and a downstream AUG start site result in the production of two isoforms with distinct N-termini, in human and mouse. Under conditions of stress, such as high cell densities and methionine deprivation, there is a specific and dramatic increase in the synthesis of the non-AUG initiated protein, suggesting its importance in times of adversity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mutations affect growth and development of heart, pericardium, neural tube, vasculogenesis and erythropoeisis. Homozygous null mutants die by embryonic day 10.5. Heterozygotes have reduced body size and multiorgan hypoplasia; females have small litters. [provided by MGI curators]

Allele List at MGI

All alleles(23) : Targeted(19) Gene trapped(4)

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy1	T	A	11: 7,119,410 (GRCm39)		probably benign	Het
Ahnak	A	G	19: 8,981,533 (GRCm39)	N939S	probably benign	Het
Cblb	C	A	16: 51,867,550 (GRCm39)		probably benign	Het
Cd22	A	G	7: 30,569,308 (GRCm39)	S603P	probably damaging	Het
Col6a6	G	A	9: 105,626,109 (GRCm39)	R1515C	possibly damaging	Het
Csf1r	C	A	18: 61,247,884 (GRCm39)	D317E	probably benign	Het
Dlg2	T	C	7: 92,091,803 (GRCm39)		probably benign	Het
Enpp3	G	A	10: 24,660,851 (GRCm39)		probably benign	Het
G530012D18Rik	CAGAGAGA	CAGAGAGAGA	1: 85,504,945 (GRCm39)		probably null	Het
Gm5828	A	T	1: 16,839,353 (GRCm39)		noncoding transcript	Het
Gpr137c	T	C	14: 45,516,522 (GRCm39)		probably benign	Het
Ibtk	A	G	9: 85,602,795 (GRCm39)		probably null	Het
Kctd7	A	G	5: 130,177,058 (GRCm39)	H96R	possibly damaging	Het
Lmcd1	T	A	6: 112,292,673 (GRCm39)	V175E	probably benign	Het
Lrfn2	A	T	17: 49,403,277 (GRCm39)		probably null	Het
Ltbp1	C	T	17: 75,634,189 (GRCm39)		probably benign	Het
Nckap1l	A	G	15: 103,364,352 (GRCm39)	E100G	probably damaging	Het
Ncs1	A	G	2: 31,174,705 (GRCm39)	N143S	probably benign	Het
Nmnat2	A	G	1: 152,987,949 (GRCm39)	D238G	probably benign	Het
Or10ag57	T	A	2: 87,218,553 (GRCm39)	V168E	probably benign	Het
Ppp2r3d	G	A	9: 101,071,593 (GRCm39)	T675I	probably damaging	Het
Psma2	A	G	13: 14,787,876 (GRCm39)	Y6C	probably damaging	Het
Rspo4	G	A	2: 151,709,846 (GRCm39)	E84K	probably damaging	Het
Shank2	G	A	7: 143,965,457 (GRCm39)	V1015I	probably benign	Het
Slc35e1	T	C	8: 73,246,415 (GRCm39)		probably benign	Het
Smg8	T	C	11: 86,974,436 (GRCm39)	D632G	possibly damaging	Het
Sppl2a	A	T	2: 126,755,441 (GRCm39)		probably benign	Het
Svep1	A	G	4: 58,066,427 (GRCm39)		probably null	Het
Ttn	T	A	2: 76,776,044 (GRCm39)	K1666M	probably damaging	Het
Ulk1	A	G	5: 110,937,206 (GRCm39)		probably null	Het
Unc80	A	G	1: 66,594,254 (GRCm39)	D1211G	possibly damaging	Het
Vmn2r112	A	G	17: 22,822,228 (GRCm39)	Q302R	probably benign	Het
Vmn2r6	A	G	3: 64,464,211 (GRCm39)	S208P	possibly damaging	Het
Wnk1	C	T	6: 119,925,418 (GRCm39)	V1847I	probably benign	Het
Zfp653	A	T	9: 21,967,718 (GRCm39)	I529N	probably damaging	Het
Zfp948	T	C	17: 21,807,104 (GRCm39)	S99P	probably damaging	Het
Zfyve9	A	G	4: 108,550,508 (GRCm39)		probably benign	Het
Zscan29	T	C	2: 120,996,984 (GRCm39)	T246A	probably damaging	Het

Other mutations in Myc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00155:Myc	APN	15	61,861,669 (GRCm39)	missense	probably benign	0.03
IGL02372:Myc	APN	15	61,859,707 (GRCm39)	missense	probably damaging	1.00
IGL02400:Myc	APN	15	61,861,760 (GRCm39)	unclassified	probably benign
IGL02677:Myc	APN	15	61,861,513 (GRCm39)	missense	probably damaging	1.00
IGL02834:Myc	APN	15	61,859,515 (GRCm39)	missense	probably damaging	1.00
IGL03330:Myc	APN	15	61,859,998 (GRCm39)	missense	probably benign
PIT1430001:Myc	UTSW	15	61,859,542 (GRCm39)	missense	probably damaging	1.00
R2105:Myc	UTSW	15	61,859,951 (GRCm39)	missense	probably damaging	1.00
R4373:Myc	UTSW	15	61,861,513 (GRCm39)	missense	probably damaging	0.99
R6774:Myc	UTSW	15	61,860,128 (GRCm39)	critical splice donor site	probably null
R6813:Myc	UTSW	15	61,860,001 (GRCm39)	missense	probably damaging	1.00
R7371:Myc	UTSW	15	61,860,031 (GRCm39)	missense	probably damaging	0.97
R8376:Myc	UTSW	15	61,859,395 (GRCm39)	missense	possibly damaging	0.94
R9729:Myc	UTSW	15	61,859,935 (GRCm39)	missense	probably damaging	0.99
RF020:Myc	UTSW	15	61,857,672 (GRCm39)	unclassified	probably benign

Predicted Primers

PCR Primer
(F):5'- GGAAGAAATTCGAGCTGCTTCCCAC -3'
(R):5'- AAGACCACTGAGGGGTCAATGCAC -3'

Sequencing Primer
(F):5'- ATCCTATGTTGCGGTCGCT -3'
(R):5'- TCAATGCACTCGGACGC -3'

Posted On

2014-01-29