Incidental Mutation 'R1245:Lrfn2'
Institutional Source Beutler Lab
Gene Symbol Lrfn2
Ensembl Gene ENSMUSG00000040490
Gene Nameleucine rich repeat and fibronectin type III domain containing 2
Synonyms5730420O05Rik, SALM1
MMRRC Submission 039312-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1245 (G1)
Quality Score225
Status Validated
Chromosomal Location48932379-49097588 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to T at 49096249 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000047573 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046254]
Predicted Effect probably null
Transcript: ENSMUST00000046254
SMART Domains Protein: ENSMUSP00000047573
Gene: ENSMUSG00000040490

low complexity region 4 16 N/A INTRINSIC
LRRNT 20 56 2.9e0 SMART
LRR 75 98 7.36e0 SMART
LRR_TYP 99 122 1.1e-2 SMART
LRR_TYP 123 146 2.2e-2 SMART
LRR 148 171 4.45e1 SMART
LRR_TYP 172 195 1.56e-2 SMART
LRR 196 220 1.06e1 SMART
LRRCT 242 287 5.53e-4 SMART
IGc2 301 366 8e-12 SMART
low complexity region 401 415 N/A INTRINSIC
FN3 420 500 1.52e-1 SMART
transmembrane domain 533 555 N/A INTRINSIC
low complexity region 613 654 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200509
Meta Mutation Damage Score 0.9481 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency 98% (41/42)
MGI Phenotype PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit small spleens, small or no thymi, impaired T cell development, and decreased T cell proliferation in response to mitogen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 T A 11: 7,169,410 probably benign Het
Ahnak A G 19: 9,004,169 N939S probably benign Het
Cblb C A 16: 52,047,187 probably benign Het
Cd22 A G 7: 30,869,883 S603P probably damaging Het
Col6a6 G A 9: 105,748,910 R1515C possibly damaging Het
Csf1r C A 18: 61,114,812 D317E probably benign Het
Dlg2 T C 7: 92,442,595 probably benign Het
Enpp3 G A 10: 24,784,953 probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gm5828 A T 1: 16,769,129 noncoding transcript Het
Gpr137c T C 14: 45,279,065 probably benign Het
Ibtk A G 9: 85,720,742 probably null Het
Kctd7 A G 5: 130,148,217 H96R possibly damaging Het
Lmcd1 T A 6: 112,315,712 V175E probably benign Het
Ltbp1 C T 17: 75,327,194 probably benign Het
Myc A G 15: 61,987,897 I140V probably damaging Het
Nckap1l A G 15: 103,455,925 E100G probably damaging Het
Ncs1 A G 2: 31,284,693 N143S probably benign Het
Nmnat2 A G 1: 153,112,203 D238G probably benign Het
Olfr1122 T A 2: 87,388,209 V168E probably benign Het
Ppp2r3a G A 9: 101,194,394 T675I probably damaging Het
Psma2 A G 13: 14,613,291 Y6C probably damaging Het
Rspo4 G A 2: 151,867,926 E84K probably damaging Het
Shank2 G A 7: 144,411,720 V1015I probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Smg8 T C 11: 87,083,610 D632G possibly damaging Het
Sppl2a A T 2: 126,913,521 probably benign Het
Svep1 A G 4: 58,066,427 probably null Het
Ttn T A 2: 76,945,700 K1666M probably damaging Het
Ulk1 A G 5: 110,789,340 probably null Het
Unc80 A G 1: 66,555,095 D1211G possibly damaging Het
Vmn2r112 A G 17: 22,603,247 Q302R probably benign Het
Vmn2r6 A G 3: 64,556,790 S208P possibly damaging Het
Wnk1 C T 6: 119,948,457 V1847I probably benign Het
Zfp653 A T 9: 22,056,422 I529N probably damaging Het
Zfp948 T C 17: 21,586,842 S99P probably damaging Het
Zfyve9 A G 4: 108,693,311 probably benign Het
Zscan29 T C 2: 121,166,503 T246A probably damaging Het
Other mutations in Lrfn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01612:Lrfn2 APN 17 49070397 missense possibly damaging 0.81
IGL01989:Lrfn2 APN 17 49071085 missense probably damaging 1.00
IGL03324:Lrfn2 APN 17 49070887 missense probably damaging 1.00
IGL02991:Lrfn2 UTSW 17 49070704 missense probably damaging 1.00
R0306:Lrfn2 UTSW 17 49096255 missense probably damaging 0.99
R0539:Lrfn2 UTSW 17 49071044 missense probably damaging 1.00
R1414:Lrfn2 UTSW 17 49070829 missense probably benign 0.01
R1437:Lrfn2 UTSW 17 49071225 missense probably damaging 0.97
R1670:Lrfn2 UTSW 17 49096577 missense probably benign 0.01
R2358:Lrfn2 UTSW 17 49071160 missense possibly damaging 0.92
R3711:Lrfn2 UTSW 17 49071160 missense possibly damaging 0.92
R3712:Lrfn2 UTSW 17 49071160 missense possibly damaging 0.92
R4521:Lrfn2 UTSW 17 49069894 start codon destroyed probably null 0.02
R4532:Lrfn2 UTSW 17 49070536 missense probably damaging 1.00
R4724:Lrfn2 UTSW 17 49070434 missense probably damaging 1.00
R5062:Lrfn2 UTSW 17 49070500 missense probably damaging 1.00
R5066:Lrfn2 UTSW 17 49096420 missense probably damaging 1.00
R5348:Lrfn2 UTSW 17 49096690 missense probably benign
R5673:Lrfn2 UTSW 17 49096597 missense probably benign 0.02
R5900:Lrfn2 UTSW 17 49070263 missense possibly damaging 0.82
R6014:Lrfn2 UTSW 17 49069906 missense possibly damaging 0.96
R6087:Lrfn2 UTSW 17 49071126 missense probably benign
R6224:Lrfn2 UTSW 17 49096351 missense probably damaging 1.00
R6229:Lrfn2 UTSW 17 49097132 missense possibly damaging 0.88
R6342:Lrfn2 UTSW 17 49097000 missense probably benign 0.27
R6408:Lrfn2 UTSW 17 49070626 missense probably damaging 1.00
R7026:Lrfn2 UTSW 17 49096977 missense probably benign 0.00
R7505:Lrfn2 UTSW 17 49096451 missense probably benign 0.14
R7852:Lrfn2 UTSW 17 49069944 missense possibly damaging 0.69
R7918:Lrfn2 UTSW 17 49071184 missense probably damaging 0.99
R8375:Lrfn2 UTSW 17 49096823 missense possibly damaging 0.73
R8733:Lrfn2 UTSW 17 49096796 missense probably damaging 0.96
R8828:Lrfn2 UTSW 17 49097104 missense probably damaging 1.00
R8872:Lrfn2 UTSW 17 49071249 nonsense probably null
R8892:Lrfn2 UTSW 17 49070348 missense probably damaging 1.00
Z1177:Lrfn2 UTSW 17 49070012 frame shift probably null
Z1177:Lrfn2 UTSW 17 49070095 missense probably benign 0.03
Z1177:Lrfn2 UTSW 17 49096715 missense probably damaging 0.99
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- actcttccctctcctctccc -3'
Posted On2014-01-29