Incidental Mutation 'R1245:Csf1r'
ID 152145
Institutional Source Beutler Lab
Gene Symbol Csf1r
Ensembl Gene ENSMUSG00000024621
Gene Name colony stimulating factor 1 receptor
Synonyms Csfmr, Fms, CSF-1R, Fim2, Fim-2, M-CSFR, CD115
MMRRC Submission 039312-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.906) question?
Stock # R1245 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 61238644-61264211 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 61247884 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 317 (D317E)
Ref Sequence ENSEMBL: ENSMUSP00000110923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025523] [ENSMUST00000115268]
AlphaFold P09581
PDB Structure Structure of M-CSF bound to the first three domains of FMS [X-RAY DIFFRACTION]
Structure of mouse Interleukin-34 in complex with mouse FMS [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000025523
AA Change: D317E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000025523
Gene: ENSMUSG00000024621
AA Change: D317E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 27 102 4.63e-8 SMART
IG 112 196 7.82e-6 SMART
IGc2 215 285 1.36e-5 SMART
IG 308 397 3.2e-2 SMART
IG_like 402 504 1.8e2 SMART
transmembrane domain 513 535 N/A INTRINSIC
TyrKc 580 908 1.45e-134 SMART
low complexity region 926 954 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115268
AA Change: D317E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110923
Gene: ENSMUSG00000024621
AA Change: D317E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 27 102 4.63e-8 SMART
IG 112 196 7.82e-6 SMART
IGc2 215 285 1.36e-5 SMART
IG 308 397 3.2e-2 SMART
IG_like 402 504 1.8e2 SMART
transmembrane domain 513 535 N/A INTRINSIC
TyrKc 580 908 1.45e-134 SMART
low complexity region 926 954 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183458
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the receptor for colony stimulating factor 1, a cytokine which controls the production, differentiation, and function of macrophages. This receptor mediates most if not all of the biological effects of this cytokine. Ligand binding activates the receptor kinase through a process of oligomerization and transphosphorylation. The encoded protein is a tyrosine kinase transmembrane receptor and member of the CSF1/PDGF receptor family of tyrosine-protein kinases. Mutations in this gene have been associated with a predisposition to myeloid malignancy. The first intron of this gene contains a transcriptionally inactive ribosomal protein L7 processed pseudogene oriented in the opposite direction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit skeletal, sensory, and reproductive abnormalities associated with severe deficiencies in osteoclasts, macrophages, and brain microglia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 T A 11: 7,119,410 (GRCm39) probably benign Het
Ahnak A G 19: 8,981,533 (GRCm39) N939S probably benign Het
Cblb C A 16: 51,867,550 (GRCm39) probably benign Het
Cd22 A G 7: 30,569,308 (GRCm39) S603P probably damaging Het
Col6a6 G A 9: 105,626,109 (GRCm39) R1515C possibly damaging Het
Dlg2 T C 7: 92,091,803 (GRCm39) probably benign Het
Enpp3 G A 10: 24,660,851 (GRCm39) probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,504,945 (GRCm39) probably null Het
Gm5828 A T 1: 16,839,353 (GRCm39) noncoding transcript Het
Gpr137c T C 14: 45,516,522 (GRCm39) probably benign Het
Ibtk A G 9: 85,602,795 (GRCm39) probably null Het
Kctd7 A G 5: 130,177,058 (GRCm39) H96R possibly damaging Het
Lmcd1 T A 6: 112,292,673 (GRCm39) V175E probably benign Het
Lrfn2 A T 17: 49,403,277 (GRCm39) probably null Het
Ltbp1 C T 17: 75,634,189 (GRCm39) probably benign Het
Myc A G 15: 61,859,746 (GRCm39) I140V probably damaging Het
Nckap1l A G 15: 103,364,352 (GRCm39) E100G probably damaging Het
Ncs1 A G 2: 31,174,705 (GRCm39) N143S probably benign Het
Nmnat2 A G 1: 152,987,949 (GRCm39) D238G probably benign Het
Or10ag57 T A 2: 87,218,553 (GRCm39) V168E probably benign Het
Ppp2r3d G A 9: 101,071,593 (GRCm39) T675I probably damaging Het
Psma2 A G 13: 14,787,876 (GRCm39) Y6C probably damaging Het
Rspo4 G A 2: 151,709,846 (GRCm39) E84K probably damaging Het
Shank2 G A 7: 143,965,457 (GRCm39) V1015I probably benign Het
Slc35e1 T C 8: 73,246,415 (GRCm39) probably benign Het
Smg8 T C 11: 86,974,436 (GRCm39) D632G possibly damaging Het
Sppl2a A T 2: 126,755,441 (GRCm39) probably benign Het
Svep1 A G 4: 58,066,427 (GRCm39) probably null Het
Ttn T A 2: 76,776,044 (GRCm39) K1666M probably damaging Het
Ulk1 A G 5: 110,937,206 (GRCm39) probably null Het
Unc80 A G 1: 66,594,254 (GRCm39) D1211G possibly damaging Het
Vmn2r112 A G 17: 22,822,228 (GRCm39) Q302R probably benign Het
Vmn2r6 A G 3: 64,464,211 (GRCm39) S208P possibly damaging Het
Wnk1 C T 6: 119,925,418 (GRCm39) V1847I probably benign Het
Zfp653 A T 9: 21,967,718 (GRCm39) I529N probably damaging Het
Zfp948 T C 17: 21,807,104 (GRCm39) S99P probably damaging Het
Zfyve9 A G 4: 108,550,508 (GRCm39) probably benign Het
Zscan29 T C 2: 120,996,984 (GRCm39) T246A probably damaging Het
Other mutations in Csf1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01403:Csf1r APN 18 61,247,897 (GRCm39) missense probably benign 0.08
IGL01603:Csf1r APN 18 61,262,373 (GRCm39) missense probably damaging 1.00
IGL02377:Csf1r APN 18 61,257,540 (GRCm39) splice site probably benign
IGL03000:Csf1r APN 18 61,242,724 (GRCm39) missense probably damaging 0.97
IGL03011:Csf1r APN 18 61,243,473 (GRCm39) missense probably benign 0.00
IGL03132:Csf1r APN 18 61,261,171 (GRCm39) missense probably benign 0.03
IGL03189:Csf1r APN 18 61,239,058 (GRCm39) missense probably benign 0.05
IGL03224:Csf1r APN 18 61,245,134 (GRCm39) missense probably damaging 0.96
IGL03351:Csf1r APN 18 61,250,180 (GRCm39) nonsense probably null
ANU74:Csf1r UTSW 18 61,250,463 (GRCm39) missense probably benign 0.09
R1363:Csf1r UTSW 18 61,257,917 (GRCm39) missense possibly damaging 0.95
R1651:Csf1r UTSW 18 61,243,473 (GRCm39) missense possibly damaging 0.64
R1785:Csf1r UTSW 18 61,262,149 (GRCm39) missense probably damaging 0.98
R1786:Csf1r UTSW 18 61,262,149 (GRCm39) missense probably damaging 0.98
R1902:Csf1r UTSW 18 61,263,213 (GRCm39) missense probably damaging 0.99
R1968:Csf1r UTSW 18 61,245,867 (GRCm39) missense probably benign 0.00
R2177:Csf1r UTSW 18 61,248,015 (GRCm39) splice site probably benign
R3743:Csf1r UTSW 18 61,247,846 (GRCm39) missense probably benign 0.01
R3809:Csf1r UTSW 18 61,245,836 (GRCm39) missense probably benign 0.22
R4374:Csf1r UTSW 18 61,252,078 (GRCm39) missense probably damaging 0.99
R4683:Csf1r UTSW 18 61,257,983 (GRCm39) missense probably damaging 1.00
R4973:Csf1r UTSW 18 61,262,119 (GRCm39) missense probably damaging 1.00
R5080:Csf1r UTSW 18 61,257,373 (GRCm39) missense probably damaging 1.00
R5314:Csf1r UTSW 18 61,262,796 (GRCm39) missense probably damaging 1.00
R5936:Csf1r UTSW 18 61,258,880 (GRCm39) missense probably damaging 1.00
R6015:Csf1r UTSW 18 61,242,784 (GRCm39) missense possibly damaging 0.50
R6227:Csf1r UTSW 18 61,258,900 (GRCm39) nonsense probably null
R6505:Csf1r UTSW 18 61,262,805 (GRCm39) missense probably damaging 1.00
R6602:Csf1r UTSW 18 61,243,497 (GRCm39) missense possibly damaging 0.81
R6811:Csf1r UTSW 18 61,252,125 (GRCm39) missense probably damaging 1.00
R6813:Csf1r UTSW 18 61,245,806 (GRCm39) missense probably benign
R7218:Csf1r UTSW 18 61,263,396 (GRCm39) missense probably damaging 1.00
R7480:Csf1r UTSW 18 61,250,610 (GRCm39) missense probably benign 0.06
R7752:Csf1r UTSW 18 61,243,368 (GRCm39) missense probably damaging 1.00
R7762:Csf1r UTSW 18 61,243,572 (GRCm39) missense probably benign 0.01
R7901:Csf1r UTSW 18 61,243,368 (GRCm39) missense probably damaging 1.00
R7953:Csf1r UTSW 18 61,257,947 (GRCm39) missense probably damaging 1.00
R7986:Csf1r UTSW 18 61,247,904 (GRCm39) missense probably benign 0.00
R8012:Csf1r UTSW 18 61,250,136 (GRCm39) missense possibly damaging 0.86
R8043:Csf1r UTSW 18 61,257,947 (GRCm39) missense probably damaging 1.00
R8296:Csf1r UTSW 18 61,250,750 (GRCm39) missense probably damaging 1.00
R8355:Csf1r UTSW 18 61,261,222 (GRCm39) missense probably damaging 1.00
R8371:Csf1r UTSW 18 61,250,663 (GRCm39) missense probably benign 0.26
R8421:Csf1r UTSW 18 61,260,966 (GRCm39) missense probably damaging 1.00
R8493:Csf1r UTSW 18 61,247,954 (GRCm39) missense probably damaging 0.98
R8726:Csf1r UTSW 18 61,250,728 (GRCm39) missense probably benign 0.17
R8786:Csf1r UTSW 18 61,247,942 (GRCm39) missense probably damaging 0.98
R9262:Csf1r UTSW 18 61,243,406 (GRCm39) missense probably benign 0.00
R9555:Csf1r UTSW 18 61,243,473 (GRCm39) missense possibly damaging 0.64
R9627:Csf1r UTSW 18 61,260,972 (GRCm39) missense probably damaging 1.00
R9778:Csf1r UTSW 18 61,260,957 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGGGTGGAGGCTCTAAACCTGATG -3'
(R):5'- TCCCAGGGACCCTGATAATATGCAC -3'

Sequencing Primer
(F):5'- TGCATAGATGTGCTCAGACC -3'
(R):5'- cacacacacacacacacac -3'
Posted On 2014-01-29