Incidental Mutation 'R1246:Pik3cd'
ID152149
Institutional Source Beutler Lab
Gene Symbol Pik3cd
Ensembl Gene ENSMUSG00000039936
Gene Namephosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit delta
Synonyms2410099E07Rik, p110delta, 2610208K16Rik
MMRRC Submission 039313-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R1246 (G1)
Quality Score161
Status Not validated
Chromosome4
Chromosomal Location149649168-149702571 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 149659800 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 165 (Y165H)
Ref Sequence ENSEMBL: ENSMUSP00000119858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038859] [ENSMUST00000105688] [ENSMUST00000105689] [ENSMUST00000105690] [ENSMUST00000118704] [ENSMUST00000122059] [ENSMUST00000127273] [ENSMUST00000131224] [ENSMUST00000134534] [ENSMUST00000146612] [ENSMUST00000156309] [ENSMUST00000177654]
Predicted Effect probably benign
Transcript: ENSMUST00000038859
AA Change: Y165H

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000036434
Gene: ENSMUSG00000039936
AA Change: Y165H

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
PI3K_rbd 174 281 1.3e-13 SMART
PI3K_C2 309 412 1.87e-28 SMART
PI3Ka 496 685 8.56e-87 SMART
PI3Kc 776 1042 5.65e-128 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105688
AA Change: Y165H

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000101313
Gene: ENSMUSG00000039936
AA Change: Y165H

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
PI3K_rbd 174 281 1.3e-13 SMART
PI3K_C2 309 412 1.87e-28 SMART
PI3Ka 496 685 8.56e-87 SMART
PI3Kc 775 1041 5.65e-128 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105689
AA Change: Y165H

PolyPhen 2 Score 0.255 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000101314
Gene: ENSMUSG00000039936
AA Change: Y165H

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
PI3K_rbd 174 281 1.3e-13 SMART
PI3K_C2 309 412 1.87e-28 SMART
PI3Ka 496 684 1.35e-84 SMART
PI3Kc 774 1040 5.65e-128 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105690
AA Change: Y165H

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000101315
Gene: ENSMUSG00000039936
AA Change: Y165H

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
PI3K_rbd 174 281 1.3e-13 SMART
PI3K_C2 309 412 1.87e-28 SMART
PI3Ka 496 688 1.22e-82 SMART
PI3Kc 778 1044 5.65e-128 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000118704
AA Change: Y165H

PolyPhen 2 Score 0.453 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112863
Gene: ENSMUSG00000039936
AA Change: Y165H

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
PI3K_rbd 174 281 1.3e-13 SMART
PI3K_C2 309 412 1.87e-28 SMART
PI3Ka 496 687 1.8e-80 SMART
PI3Kc 777 1043 5.65e-128 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122059
AA Change: Y165H

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000113844
Gene: ENSMUSG00000039936
AA Change: Y165H

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
PI3K_rbd 174 281 1.3e-13 SMART
PI3K_C2 309 408 6.47e-23 SMART
PI3Ka 492 681 8.56e-87 SMART
PI3Kc 771 1037 5.65e-128 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000127273
AA Change: Y165H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119858
Gene: ENSMUSG00000039936
AA Change: Y165H

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
Blast:PI3K_rbd 126 171 1e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000131224
SMART Domains Protein: ENSMUSP00000115542
Gene: ENSMUSG00000039936

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134534
SMART Domains Protein: ENSMUSP00000118988
Gene: ENSMUSG00000039936

DomainStartEndE-ValueType
Pfam:PI3K_p85B 31 62 1.9e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146612
SMART Domains Protein: ENSMUSP00000121843
Gene: ENSMUSG00000039936

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156309
Predicted Effect probably benign
Transcript: ENSMUST00000177654
AA Change: Y165H

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000136045
Gene: ENSMUSG00000039936
AA Change: Y165H

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
PI3K_rbd 174 281 1.3e-13 SMART
PI3K_C2 309 412 1.87e-28 SMART
PI3Ka 496 688 1.22e-82 SMART
PI3Kc 778 1044 5.65e-128 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185093
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphoinositide 3-kinases (PI3Ks) phosphorylate inositol lipids and are involved in the immune response. The protein encoded by this gene is a class I PI3K found primarily in leukocytes. Like other class I PI3Ks (p110-alpha p110-beta, and p110-gamma), the encoded protein binds p85 adapter proteins and GTP-bound RAS. However, unlike the other class I PI3Ks, this protein phosphorylates itself, not p85 protein.[provided by RefSeq, Jul 2010]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired B and T cell antigen receptor signaling, reduced or ablated immune responses and decreased immunoglobulin levels. Mutants also develop inflammatory bowel disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 14 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029F12Rik T C 13: 97,030,295 D71G unknown Het
Gm11563 T C 11: 99,658,848 T27A unknown Het
Gm7361 G T 5: 26,261,227 E196* probably null Het
Ltbp1 T A 17: 75,385,161 Y1273* probably null Het
Nol8 T A 13: 49,676,769 W1110R probably damaging Het
Olfr547 T A 7: 102,534,942 L65H probably damaging Het
Olfr661 C A 7: 104,688,164 L50I possibly damaging Het
Olfr906 T C 9: 38,488,790 S254P probably damaging Het
Pde4d T A 13: 109,950,973 W625R probably damaging Het
Pigg T C 5: 108,341,820 Y631H probably damaging Het
Rap1gap A G 4: 137,712,094 E114G possibly damaging Het
Tubb2b G A 13: 34,128,147 T221I possibly damaging Het
Ythdf2 G A 4: 132,204,871 T326M probably benign Het
Zzef1 A G 11: 72,874,909 I1421V probably benign Het
Other mutations in Pik3cd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Pik3cd APN 4 149657460 missense probably damaging 1.00
IGL01536:Pik3cd APN 4 149652666 missense probably damaging 1.00
IGL01636:Pik3cd APN 4 149654315 missense possibly damaging 0.82
IGL02794:Pik3cd APN 4 149654571 missense probably benign
grand_tetons UTSW 4 149652699 missense probably damaging 1.00
stinger UTSW 4 149657319 missense probably damaging 1.00
F5770:Pik3cd UTSW 4 149657319 missense probably damaging 1.00
R0003:Pik3cd UTSW 4 149656379 critical splice donor site probably null
R0309:Pik3cd UTSW 4 149663220 missense probably damaging 1.00
R1259:Pik3cd UTSW 4 149650648 nonsense probably null
R1533:Pik3cd UTSW 4 149655196 missense probably damaging 1.00
R1756:Pik3cd UTSW 4 149658750 missense probably benign 0.02
R1796:Pik3cd UTSW 4 149654119 missense possibly damaging 0.83
R1887:Pik3cd UTSW 4 149652634 missense probably damaging 1.00
R1988:Pik3cd UTSW 4 149663203 missense probably damaging 1.00
R2089:Pik3cd UTSW 4 149652699 missense probably damaging 1.00
R2091:Pik3cd UTSW 4 149652699 missense probably damaging 1.00
R4997:Pik3cd UTSW 4 149658984 missense probably damaging 1.00
R5391:Pik3cd UTSW 4 149659131 missense probably damaging 0.98
R5603:Pik3cd UTSW 4 149658855 missense probably benign
R6282:Pik3cd UTSW 4 149659743 missense probably benign 0.00
R6453:Pik3cd UTSW 4 149652302 missense probably damaging 1.00
R7286:Pik3cd UTSW 4 149659714 missense probably benign 0.08
R7423:Pik3cd UTSW 4 149651763 critical splice donor site probably null
R7508:Pik3cd UTSW 4 149654583 missense possibly damaging 0.78
R7665:Pik3cd UTSW 4 149654050 missense possibly damaging 0.70
R7897:Pik3cd UTSW 4 149657269 missense probably benign 0.06
R7980:Pik3cd UTSW 4 149657269 missense probably benign 0.06
R8039:Pik3cd UTSW 4 149659866 missense possibly damaging 0.91
V7580:Pik3cd UTSW 4 149657319 missense probably damaging 1.00
V7581:Pik3cd UTSW 4 149657319 missense probably damaging 1.00
V7582:Pik3cd UTSW 4 149657319 missense probably damaging 1.00
V7583:Pik3cd UTSW 4 149657319 missense probably damaging 1.00
X0023:Pik3cd UTSW 4 149660034 missense probably benign 0.04
Z1176:Pik3cd UTSW 4 149654847 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGCCCTCATATGCTACTGGGAGAAG -3'
(R):5'- GGACCGCGTGAAGAAGCTCATTAAC -3'

Sequencing Primer
(F):5'- CTCATATGCTACTGGGAGAAGGAATG -3'
(R):5'- AGCCTCCTCATTGGCAAAGG -3'
Posted On2014-01-29