Mutagenetix > Incidental Mutation

Incidental Mutation 'R1246:Pik3cd'

152149

Institutional Source

Beutler Lab

Gene Symbol

Pik3cd

Ensembl Gene

ENSMUSG00000039936

Gene Name

phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit delta

Synonyms

2610208K16Rik, 2410099E07Rik, p110delta

MMRRC Submission

039313-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.959) question?

Stock #

R1246 (G1)

Quality Score

161

Status

Not validated

Chromosome

Chromosomal Location

149733625-149787023 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 149744257 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 165 (Y165H)

Ref Sequence

ENSEMBL: ENSMUSP00000119858 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038859] [ENSMUST00000105688] [ENSMUST00000105689] [ENSMUST00000105690] [ENSMUST00000118704] [ENSMUST00000122059] [ENSMUST00000127273] [ENSMUST00000177654] [ENSMUST00000146612] [ENSMUST00000131224] [ENSMUST00000156309] [ENSMUST00000134534]

AlphaFold

O35904

Predicted Effect

probably benign
Transcript: ENSMUST00000038859
AA Change: Y165H

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000036434
Gene: ENSMUSG00000039936
AA Change: Y165H

Domain	Start	End	E-Value	Type
PI3K_p85B	31	108	2.24e-26	SMART
PI3K_rbd	174	281	1.3e-13	SMART
PI3K_C2	309	412	1.87e-28	SMART
PI3Ka	496	685	8.56e-87	SMART
PI3Kc	776	1042	5.65e-128	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000105688
AA Change: Y165H

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000101313
Gene: ENSMUSG00000039936
AA Change: Y165H

Domain	Start	End	E-Value	Type
PI3K_p85B	31	108	2.24e-26	SMART
PI3K_rbd	174	281	1.3e-13	SMART
PI3K_C2	309	412	1.87e-28	SMART
PI3Ka	496	685	8.56e-87	SMART
PI3Kc	775	1041	5.65e-128	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000105689
AA Change: Y165H

PolyPhen 2 Score 0.255 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000101314
Gene: ENSMUSG00000039936
AA Change: Y165H

Domain	Start	End	E-Value	Type
PI3K_p85B	31	108	2.24e-26	SMART
PI3K_rbd	174	281	1.3e-13	SMART
PI3K_C2	309	412	1.87e-28	SMART
PI3Ka	496	684	1.35e-84	SMART
PI3Kc	774	1040	5.65e-128	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000105690
AA Change: Y165H

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000101315
Gene: ENSMUSG00000039936
AA Change: Y165H

Domain	Start	End	E-Value	Type
PI3K_p85B	31	108	2.24e-26	SMART
PI3K_rbd	174	281	1.3e-13	SMART
PI3K_C2	309	412	1.87e-28	SMART
PI3Ka	496	688	1.22e-82	SMART
PI3Kc	778	1044	5.65e-128	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000118704
AA Change: Y165H

PolyPhen 2 Score 0.453 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000112863
Gene: ENSMUSG00000039936
AA Change: Y165H

Domain	Start	End	E-Value	Type
PI3K_p85B	31	108	2.24e-26	SMART
PI3K_rbd	174	281	1.3e-13	SMART
PI3K_C2	309	412	1.87e-28	SMART
PI3Ka	496	687	1.8e-80	SMART
PI3Kc	777	1043	5.65e-128	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000122059
AA Change: Y165H

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000113844
Gene: ENSMUSG00000039936
AA Change: Y165H

Domain	Start	End	E-Value	Type
PI3K_p85B	31	108	2.24e-26	SMART
PI3K_rbd	174	281	1.3e-13	SMART
PI3K_C2	309	408	6.47e-23	SMART
PI3Ka	492	681	8.56e-87	SMART
PI3Kc	771	1037	5.65e-128	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000127273
AA Change: Y165H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000119858
Gene: ENSMUSG00000039936
AA Change: Y165H

Domain	Start	End	E-Value	Type
PI3K_p85B	31	108	2.24e-26	SMART
Blast:PI3K_rbd	126	171	1e-15	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000177654
AA Change: Y165H

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000136045
Gene: ENSMUSG00000039936
AA Change: Y165H

Domain	Start	End	E-Value	Type
PI3K_p85B	31	108	2.24e-26	SMART
PI3K_rbd	174	281	1.3e-13	SMART
PI3K_C2	309	412	1.87e-28	SMART
PI3Ka	496	688	1.22e-82	SMART
PI3Kc	778	1044	5.65e-128	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185093

Predicted Effect

probably benign
Transcript: ENSMUST00000146612

SMART Domains

Protein: ENSMUSP00000121843
Gene: ENSMUSG00000039936

Domain	Start	End	E-Value	Type
PI3K_p85B	31	108	2.24e-26	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000131224

SMART Domains

Protein: ENSMUSP00000115542
Gene: ENSMUSG00000039936

Domain	Start	End	E-Value	Type
PI3K_p85B	31	108	2.24e-26	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000156309

Predicted Effect

probably benign
Transcript: ENSMUST00000134534

SMART Domains

Protein: ENSMUSP00000118988
Gene: ENSMUSG00000039936

Domain	Start	End	E-Value	Type
Pfam:PI3K_p85B	31	62	1.9e-10	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphoinositide 3-kinases (PI3Ks) phosphorylate inositol lipids and are involved in the immune response. The protein encoded by this gene is a class I PI3K found primarily in leukocytes. Like other class I PI3Ks (p110-alpha p110-beta, and p110-gamma), the encoded protein binds p85 adapter proteins and GTP-bound RAS. However, unlike the other class I PI3Ks, this protein phosphorylates itself, not p85 protein.[provided by RefSeq, Jul 2010]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired B and T cell antigen receptor signaling, reduced or ablated immune responses and decreased immunoglobulin levels. Mutants also develop inflammatory bowel disease. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 14 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700029F12Rik	T	C	13: 97,166,803 (GRCm39)	D71G	unknown	Het
Gm11563	T	C	11: 99,549,674 (GRCm39)	T27A	unknown	Het
Gm7361	G	T	5: 26,466,225 (GRCm39)	E196*	probably null	Het
Ltbp1	T	A	17: 75,692,156 (GRCm39)	Y1273*	probably null	Het
Nol8	T	A	13: 49,830,245 (GRCm39)	W1110R	probably damaging	Het
Or52b4	T	A	7: 102,184,149 (GRCm39)	L65H	probably damaging	Het
Or56b2	C	A	7: 104,337,371 (GRCm39)	L50I	possibly damaging	Het
Or8b1	T	C	9: 38,400,086 (GRCm39)	S254P	probably damaging	Het
Pde4d	T	A	13: 110,087,507 (GRCm39)	W625R	probably damaging	Het
Pigg	T	C	5: 108,489,686 (GRCm39)	Y631H	probably damaging	Het
Rap1gap	A	G	4: 137,439,405 (GRCm39)	E114G	possibly damaging	Het
Tubb2b	G	A	13: 34,312,130 (GRCm39)	T221I	possibly damaging	Het
Ythdf2	G	A	4: 131,932,182 (GRCm39)	T326M	probably benign	Het
Zzef1	A	G	11: 72,765,735 (GRCm39)	I1421V	probably benign	Het

Other mutations in Pik3cd

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01308:Pik3cd	APN	4	149,741,917 (GRCm39)	missense	probably damaging	1.00
IGL01536:Pik3cd	APN	4	149,737,123 (GRCm39)	missense	probably damaging	1.00
IGL01636:Pik3cd	APN	4	149,738,772 (GRCm39)	missense	possibly damaging	0.82
IGL02794:Pik3cd	APN	4	149,739,028 (GRCm39)	missense	probably benign
grand_tetons	UTSW	4	149,737,156 (GRCm39)	missense	probably damaging	1.00
Helena	UTSW	4	149,736,277 (GRCm39)	missense	probably damaging	1.00
stinger	UTSW	4	149,741,776 (GRCm39)	missense	probably damaging	1.00
F5770:Pik3cd	UTSW	4	149,741,776 (GRCm39)	missense	probably damaging	1.00
R0003:Pik3cd	UTSW	4	149,740,836 (GRCm39)	critical splice donor site	probably null
R0309:Pik3cd	UTSW	4	149,747,677 (GRCm39)	missense	probably damaging	1.00
R1259:Pik3cd	UTSW	4	149,735,105 (GRCm39)	nonsense	probably null
R1533:Pik3cd	UTSW	4	149,739,653 (GRCm39)	missense	probably damaging	1.00
R1756:Pik3cd	UTSW	4	149,743,207 (GRCm39)	missense	probably benign	0.02
R1796:Pik3cd	UTSW	4	149,738,576 (GRCm39)	missense	possibly damaging	0.83
R1887:Pik3cd	UTSW	4	149,737,091 (GRCm39)	missense	probably damaging	1.00
R1988:Pik3cd	UTSW	4	149,747,660 (GRCm39)	missense	probably damaging	1.00
R2089:Pik3cd	UTSW	4	149,737,156 (GRCm39)	missense	probably damaging	1.00
R2091:Pik3cd	UTSW	4	149,737,156 (GRCm39)	missense	probably damaging	1.00
R4997:Pik3cd	UTSW	4	149,743,441 (GRCm39)	missense	probably damaging	1.00
R5391:Pik3cd	UTSW	4	149,743,588 (GRCm39)	missense	probably damaging	0.98
R5603:Pik3cd	UTSW	4	149,743,312 (GRCm39)	missense	probably benign
R6282:Pik3cd	UTSW	4	149,744,200 (GRCm39)	missense	probably benign	0.00
R6453:Pik3cd	UTSW	4	149,736,759 (GRCm39)	missense	probably damaging	1.00
R7286:Pik3cd	UTSW	4	149,744,171 (GRCm39)	missense	probably benign	0.08
R7423:Pik3cd	UTSW	4	149,736,220 (GRCm39)	critical splice donor site	probably null
R7508:Pik3cd	UTSW	4	149,739,040 (GRCm39)	missense	possibly damaging	0.78
R7665:Pik3cd	UTSW	4	149,738,507 (GRCm39)	missense	possibly damaging	0.70
R7897:Pik3cd	UTSW	4	149,741,726 (GRCm39)	missense	probably benign	0.06
R8039:Pik3cd	UTSW	4	149,744,323 (GRCm39)	missense	possibly damaging	0.91
R8476:Pik3cd	UTSW	4	149,736,277 (GRCm39)	missense	probably damaging	1.00
R9015:Pik3cd	UTSW	4	149,740,055 (GRCm39)	missense	probably benign	0.06
R9252:Pik3cd	UTSW	4	149,740,087 (GRCm39)	missense	possibly damaging	0.88
R9704:Pik3cd	UTSW	4	149,739,839 (GRCm39)	missense	probably benign	0.17
V7580:Pik3cd	UTSW	4	149,741,776 (GRCm39)	missense	probably damaging	1.00
V7581:Pik3cd	UTSW	4	149,741,776 (GRCm39)	missense	probably damaging	1.00
V7582:Pik3cd	UTSW	4	149,741,776 (GRCm39)	missense	probably damaging	1.00
V7583:Pik3cd	UTSW	4	149,741,776 (GRCm39)	missense	probably damaging	1.00
X0023:Pik3cd	UTSW	4	149,744,491 (GRCm39)	missense	probably benign	0.04
Z1176:Pik3cd	UTSW	4	149,739,304 (GRCm39)	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- TGCCCTCATATGCTACTGGGAGAAG -3'
(R):5'- GGACCGCGTGAAGAAGCTCATTAAC -3'

Sequencing Primer
(F):5'- CTCATATGCTACTGGGAGAAGGAATG -3'
(R):5'- AGCCTCCTCATTGGCAAAGG -3'

Posted On

2014-01-29