Incidental Mutation 'R1246:Nol8'
ID 152159
Institutional Source Beutler Lab
Gene Symbol Nol8
Ensembl Gene ENSMUSG00000021392
Gene Name nucleolar protein 8
Synonyms 5730412B09Rik, D13Ertd548e, 4921532D18Rik
MMRRC Submission 039313-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1246 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 49653078-49679016 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 49676769 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 1110 (W1110R)
Ref Sequence ENSEMBL: ENSMUSP00000152878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021824] [ENSMUST00000221142] [ENSMUST00000222197] [ENSMUST00000223467]
AlphaFold Q3UHX0
Predicted Effect probably damaging
Transcript: ENSMUST00000021824
AA Change: W1128R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000021824
Gene: ENSMUSG00000021392
AA Change: W1128R

DomainStartEndE-ValueType
RRM 27 103 3.02e-9 SMART
low complexity region 315 327 N/A INTRINSIC
low complexity region 454 468 N/A INTRINSIC
low complexity region 712 724 N/A INTRINSIC
low complexity region 804 816 N/A INTRINSIC
low complexity region 836 849 N/A INTRINSIC
coiled coil region 886 916 N/A INTRINSIC
coiled coil region 955 981 N/A INTRINSIC
low complexity region 1080 1093 N/A INTRINSIC
low complexity region 1152 1164 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000221142
AA Change: W1110R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221328
Predicted Effect probably damaging
Transcript: ENSMUST00000222197
AA Change: W1128R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000223467
AA Change: W1110R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NOL8 binds Ras-related GTP-binding proteins (see MIM 608267) and plays a role in cell growth (Sekiguchi et al., 2004 [PubMed 14660641]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 14 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029F12Rik T C 13: 97,030,295 D71G unknown Het
Gm11563 T C 11: 99,658,848 T27A unknown Het
Gm7361 G T 5: 26,261,227 E196* probably null Het
Ltbp1 T A 17: 75,385,161 Y1273* probably null Het
Olfr547 T A 7: 102,534,942 L65H probably damaging Het
Olfr661 C A 7: 104,688,164 L50I possibly damaging Het
Olfr906 T C 9: 38,488,790 S254P probably damaging Het
Pde4d T A 13: 109,950,973 W625R probably damaging Het
Pigg T C 5: 108,341,820 Y631H probably damaging Het
Pik3cd A G 4: 149,659,800 Y165H probably damaging Het
Rap1gap A G 4: 137,712,094 E114G possibly damaging Het
Tubb2b G A 13: 34,128,147 T221I possibly damaging Het
Ythdf2 G A 4: 132,204,871 T326M probably benign Het
Zzef1 A G 11: 72,874,909 I1421V probably benign Het
Other mutations in Nol8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Nol8 APN 13 49662228 missense probably benign 0.01
IGL01106:Nol8 APN 13 49654481 missense possibly damaging 0.46
IGL01413:Nol8 APN 13 49659952 missense possibly damaging 0.82
IGL01540:Nol8 APN 13 49661670 missense probably benign 0.06
IGL01670:Nol8 APN 13 49661308 missense possibly damaging 0.54
IGL01672:Nol8 APN 13 49675407 missense possibly damaging 0.95
IGL02032:Nol8 APN 13 49672772 missense probably benign
IGL02212:Nol8 APN 13 49662150 missense possibly damaging 0.87
IGL02323:Nol8 APN 13 49655245 splice site probably benign
IGL02645:Nol8 APN 13 49665471 critical splice donor site probably null
IGL02949:Nol8 APN 13 49662402 missense probably benign 0.01
IGL02954:Nol8 APN 13 49661172 missense probably benign 0.01
IGL03182:Nol8 APN 13 49664081 missense probably damaging 1.00
IGL03406:Nol8 APN 13 49661568 missense probably damaging 1.00
P0047:Nol8 UTSW 13 49654348 splice site probably null
R0092:Nol8 UTSW 13 49662447 missense possibly damaging 0.54
R0099:Nol8 UTSW 13 49672689 missense probably benign
R0145:Nol8 UTSW 13 49662447 missense possibly damaging 0.54
R0269:Nol8 UTSW 13 49654445 missense possibly damaging 0.49
R0370:Nol8 UTSW 13 49662447 missense possibly damaging 0.54
R0374:Nol8 UTSW 13 49662447 missense possibly damaging 0.54
R0390:Nol8 UTSW 13 49662152 missense probably damaging 1.00
R0617:Nol8 UTSW 13 49654445 missense possibly damaging 0.49
R0635:Nol8 UTSW 13 49676758 missense probably benign 0.05
R0637:Nol8 UTSW 13 49662447 missense possibly damaging 0.54
R1446:Nol8 UTSW 13 49655227 missense probably damaging 1.00
R1464:Nol8 UTSW 13 49676788 missense probably benign
R1464:Nol8 UTSW 13 49676788 missense probably benign
R1627:Nol8 UTSW 13 49661504 missense probably benign 0.01
R1703:Nol8 UTSW 13 49667457 missense possibly damaging 0.65
R1751:Nol8 UTSW 13 49667408 missense probably benign 0.06
R2187:Nol8 UTSW 13 49661999 missense probably benign 0.00
R2357:Nol8 UTSW 13 49654504 critical splice donor site probably null
R3081:Nol8 UTSW 13 49678392 unclassified probably benign
R3969:Nol8 UTSW 13 49660016 nonsense probably null
R4199:Nol8 UTSW 13 49661748 missense possibly damaging 0.65
R4720:Nol8 UTSW 13 49662753 missense probably damaging 1.00
R4927:Nol8 UTSW 13 49654425 missense possibly damaging 0.79
R5177:Nol8 UTSW 13 49661112 missense probably benign 0.32
R5512:Nol8 UTSW 13 49676787 missense probably benign
R5744:Nol8 UTSW 13 49662326 missense possibly damaging 0.82
R5988:Nol8 UTSW 13 49672614 missense possibly damaging 0.58
R6048:Nol8 UTSW 13 49653684 critical splice donor site probably null
R6306:Nol8 UTSW 13 49676353 missense probably damaging 1.00
R6359:Nol8 UTSW 13 49664070 missense probably benign 0.16
R6378:Nol8 UTSW 13 49667355 missense probably damaging 1.00
R6655:Nol8 UTSW 13 49654392 missense probably damaging 1.00
R7035:Nol8 UTSW 13 49661202 missense probably benign 0.06
R7058:Nol8 UTSW 13 49676386 missense probably damaging 1.00
R7368:Nol8 UTSW 13 49661219 missense probably benign 0.00
R7450:Nol8 UTSW 13 49660015 missense probably benign 0.01
R7673:Nol8 UTSW 13 49664780 missense probably benign 0.15
R7750:Nol8 UTSW 13 49662266 missense possibly damaging 0.83
R8246:Nol8 UTSW 13 49655248 splice site probably benign
R9081:Nol8 UTSW 13 49661405 missense probably benign 0.00
R9127:Nol8 UTSW 13 49661999 missense probably benign 0.00
R9223:Nol8 UTSW 13 49661262 missense possibly damaging 0.63
X0020:Nol8 UTSW 13 49661165 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCCATTCAGTGGTGTGGGACAAG -3'
(R):5'- GTCAGTCAAGTCAATCTGCCCTCC -3'

Sequencing Primer
(F):5'- TACATTCTGAGGGCCAAGTG -3'
(R):5'- ctcccttccttccttccttc -3'
Posted On 2014-01-29