Mutagenetix > Incidental Mutation

Incidental Mutation 'R1247:Sox15'

152170

Institutional Source

Beutler Lab

Gene Symbol

Sox15

Ensembl Gene

ENSMUSG00000041287

Gene Name

SRY (sex determining region Y)-box 15

Synonyms

Sox16

MMRRC Submission

039314-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1247 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

69546140-69547553 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 69547320 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 190 (F190S)

Ref Sequence

ENSEMBL: ENSMUSP00000048524 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018905] [ENSMUST00000018909] [ENSMUST00000047373] [ENSMUST00000148242] [ENSMUST00000155200]

AlphaFold

P43267

Predicted Effect

probably benign
Transcript: ENSMUST00000018905

SMART Domains

Protein: ENSMUSP00000018905
Gene: ENSMUSG00000018761

Domain	Start	End	E-Value	Type
low complexity region	38	50	N/A	INTRINSIC
CTNS	56	87	1.69e-6	SMART
low complexity region	141	157	N/A	INTRINSIC
CTNS	167	198	5.56e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000018909

SMART Domains

Protein: ENSMUSP00000018909
Gene: ENSMUSG00000018765

Domain	Start	End	E-Value	Type
Pfam:Agenet	72	130	1.3e-10	PFAM
KH	227	294	3.06e-3	SMART
KH	295	366	4.16e-5	SMART
low complexity region	368	380	N/A	INTRINSIC
low complexity region	389	406	N/A	INTRINSIC
low complexity region	423	442	N/A	INTRINSIC
low complexity region	475	503	N/A	INTRINSIC
Pfam:FXR_C1	504	579	2.5e-36	PFAM
low complexity region	586	599	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000047373
AA Change: F190S

PolyPhen 2 Score 0.331 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000048524
Gene: ENSMUSG00000041287
AA Change: F190S

Domain	Start	End	E-Value	Type
low complexity region	31	45	N/A	INTRINSIC
HMG	46	116	6.83e-29	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000125389

SMART Domains

Protein: ENSMUSP00000129025
Gene: ENSMUSG00000018761

Domain	Start	End	E-Value	Type
low complexity region	21	33	N/A	INTRINSIC
CTNS	39	70	1.69e-6	SMART
low complexity region	89	104	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125586

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127118

Predicted Effect

probably benign
Transcript: ENSMUST00000129224

SMART Domains

Protein: ENSMUSP00000120001
Gene: ENSMUSG00000018761

Domain	Start	End	E-Value	Type
low complexity region	36	48	N/A	INTRINSIC
CTNS	54	85	1.69e-6	SMART
low complexity region	138	163	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132742

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149764

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153217

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137288

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139155

Predicted Effect

probably benign
Transcript: ENSMUST00000148242

SMART Domains

Protein: ENSMUSP00000133074
Gene: ENSMUSG00000018761

Domain	Start	End	E-Value	Type
low complexity region	38	50	N/A	INTRINSIC
CTNS	56	87	1.69e-6	SMART
low complexity region	98	109	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000155200

SMART Domains

Protein: ENSMUSP00000117715
Gene: ENSMUSG00000018761

Domain	Start	End	E-Value	Type
low complexity region	38	50	N/A	INTRINSIC
CTNS	56	87	1.69e-6	SMART

Coding Region Coverage

1x: 99.0%
3x: 98.3%
10x: 96.3%
20x: 92.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional regulator after forming a protein complex with other proteins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display abnormalities in muscle fiber differentiation and in muscle regeneration after injury. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 11 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930527J03Rik	ACCC	ACC	1: 178,276,503 (GRCm38)		noncoding transcript	Het
Brca2	C	A	5: 150,464,739 (GRCm39)	A1501D	probably damaging	Het
Ctbp2	G	C	7: 132,596,918 (GRCm39)	R722G	probably benign	Het
Cyp3a44	A	G	5: 145,728,477 (GRCm39)	F249S	probably damaging	Het
Huwe1	G	C	X: 150,684,566 (GRCm39)	S2199T	probably benign	Het
Pds5b	CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT	CATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTAT	5: 150,698,819 (GRCm39)		probably benign	Het
Samd4	AGG	AG	14: 47,301,785 (GRCm39)		probably benign	Het
Samd4	G	GAAA	14: 47,325,215 (GRCm39)		probably benign	Het
Slc35e1	T	C	8: 73,246,415 (GRCm39)		probably benign	Het
Syne2	G	A	12: 76,014,264 (GRCm39)	A3153T	probably benign	Het
Tbr1	C	T	2: 61,641,962 (GRCm39)	P409L	possibly damaging	Het

Other mutations in Sox15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R1340:Sox15	UTSW	11	69,546,373 (GRCm39)	missense	probably damaging	1.00
R5174:Sox15	UTSW	11	69,546,545 (GRCm39)	missense	probably damaging	1.00
R5938:Sox15	UTSW	11	69,546,556 (GRCm39)	missense	probably damaging	1.00
R5958:Sox15	UTSW	11	69,546,556 (GRCm39)	missense	probably damaging	1.00
R5959:Sox15	UTSW	11	69,546,556 (GRCm39)	missense	probably damaging	1.00
R6117:Sox15	UTSW	11	69,546,716 (GRCm39)	missense	possibly damaging	0.90
R9016:Sox15	UTSW	11	69,546,529 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTAACCCTGTCTGCTGCAAACTG -3'
(R):5'- TCCTTTTGGACCAAGGACAGAGCC -3'

Sequencing Primer
(F):5'- TGGTCAGACCAGTCCCC -3'
(R):5'- TTGCTGCTGTAGGGAGAGAATAC -3'

Posted On

2014-01-29