Incidental Mutation 'R1247:Samd4'
ID152173
Institutional Source Beutler Lab
Gene Symbol Samd4
Ensembl Gene ENSMUSG00000021838
Gene Namesterile alpha motif domain containing 4
Synonyms4933436G17Rik, 1700024G08Rik, Smaug, 1700111L17Rik
MMRRC Submission 039314-MU
Accession Numbers

Genbank: NM_001037221, NM_028966, NM_001163433

Is this an essential gene? Probably essential (E-score: 0.864) question?
Stock #R1247 (G1)
Quality Score160
Status Not validated
Chromosome14
Chromosomal Location46882854-47105815 bp(+) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) G to GAAA at 47087758 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022386] [ENSMUST00000100672] [ENSMUST00000125113] [ENSMUST00000125688] [ENSMUST00000137543] [ENSMUST00000228404]
Predicted Effect probably benign
Transcript: ENSMUST00000022386
SMART Domains Protein: ENSMUSP00000022386
Gene: ENSMUSG00000021838

DomainStartEndE-ValueType
low complexity region 82 95 N/A INTRINSIC
low complexity region 292 305 N/A INTRINSIC
SAM 320 383 1.4e-7 SMART
low complexity region 445 463 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100672
SMART Domains Protein: ENSMUSP00000098237
Gene: ENSMUSG00000021838

DomainStartEndE-ValueType
low complexity region 82 95 N/A INTRINSIC
SAM 232 295 2.75e-6 SMART
low complexity region 357 375 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125113
SMART Domains Protein: ENSMUSP00000122833
Gene: ENSMUSG00000021838

DomainStartEndE-ValueType
low complexity region 191 204 N/A INTRINSIC
SAM 219 282 1.4e-7 SMART
low complexity region 344 362 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125688
SMART Domains Protein: ENSMUSP00000115569
Gene: ENSMUSG00000021838

DomainStartEndE-ValueType
low complexity region 36 54 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130046
Predicted Effect probably benign
Transcript: ENSMUST00000137543
SMART Domains Protein: ENSMUSP00000114621
Gene: ENSMUSG00000021838

DomainStartEndE-ValueType
low complexity region 82 95 N/A INTRINSIC
SAM 232 295 2.75e-6 SMART
low complexity region 357 375 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000227848
Predicted Effect probably benign
Transcript: ENSMUST00000228404
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sterile alpha motifs (SAMs) in proteins such as SAMD4A are part of an RNA-binding domain that functions as a posttranscriptional regulator by binding to an RNA sequence motif known as the Smaug recognition element, which was named after the Drosophila Smaug protein (Baez and Boccaccio, 2005 [PubMed 16221671]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit leaness, myopathy and altered glucose metabolism. Mice homozygous for a spontaneous mutation exhibit kyphosis, abnormal gait, and decreased cortical bone thickness. [provided by MGI curators]
Allele List at MGI

ll alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 10 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930527J03Rik ACCC ACC 1: 178,276,503 noncoding transcript Het
Brca2 C A 5: 150,541,274 A1501D probably damaging Het
Ctbp2 G C 7: 132,995,189 R722G probably benign Het
Cyp3a44 A G 5: 145,791,667 F249S probably damaging Het
Huwe1 G C X: 151,901,570 S2199T probably benign Het
Pds5b CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 5: 150,775,354 probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Sox15 T C 11: 69,656,494 F190S probably benign Het
Syne2 G A 12: 75,967,490 A3153T probably benign Het
Tbr1 C T 2: 61,811,618 P409L possibly damaging Het
Other mutations in Samd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Samd4 APN 14 47052898 missense probably damaging 1.00
IGL01413:Samd4 APN 14 47016792 missense probably benign 0.01
supermodel UTSW 14 47016337 missense probably damaging 1.00
B6584:Samd4 UTSW 14 47016337 missense probably damaging 1.00
G4846:Samd4 UTSW 14 47016319 missense probably damaging 1.00
R0096:Samd4 UTSW 14 47064297 missense possibly damaging 0.88
R0122:Samd4 UTSW 14 47016560 missense probably benign 0.44
R0562:Samd4 UTSW 14 47077509 missense probably damaging 1.00
R1247:Samd4 UTSW 14 47064328 critical splice donor site probably benign
R1771:Samd4 UTSW 14 47089075 missense probably damaging 1.00
R1902:Samd4 UTSW 14 47074128 missense probably damaging 1.00
R1903:Samd4 UTSW 14 47074128 missense probably damaging 1.00
R2346:Samd4 UTSW 14 46884842 missense probably damaging 1.00
R4155:Samd4 UTSW 14 47052946 missense possibly damaging 0.74
R4498:Samd4 UTSW 14 47096109 missense probably damaging 1.00
R4510:Samd4 UTSW 14 47077585 missense probably benign 0.05
R4511:Samd4 UTSW 14 47077585 missense probably benign 0.05
R4658:Samd4 UTSW 14 47064246 missense probably damaging 1.00
R4871:Samd4 UTSW 14 47066463 missense probably damaging 1.00
R4991:Samd4 UTSW 14 47074010 missense probably damaging 0.97
R5432:Samd4 UTSW 14 47074062 missense probably benign 0.09
R5687:Samd4 UTSW 14 47016565 missense probably benign
R6035:Samd4 UTSW 14 47087872 missense probably damaging 1.00
R6035:Samd4 UTSW 14 47087872 missense probably damaging 1.00
R6254:Samd4 UTSW 14 47016631 missense probably damaging 1.00
R6366:Samd4 UTSW 14 47074150 critical splice donor site probably null
R6376:Samd4 UTSW 14 47052962 missense probably damaging 1.00
R6944:Samd4 UTSW 14 47016635 missense possibly damaging 0.94
R7035:Samd4 UTSW 14 47089163 synonymous silent
R7148:Samd4 UTSW 14 47016683 missense probably benign 0.09
R7467:Samd4 UTSW 14 47087856 missense probably benign 0.19
X0018:Samd4 UTSW 14 47016696 missense possibly damaging 0.94
X0022:Samd4 UTSW 14 47074017 missense probably benign 0.45
Z0001:Samd4 UTSW 14 47016337 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACCCACAGGTTGGACTAGACAAG -3'
(R):5'- GCTGGTTGGAGCTGACAAATCCAC -3'

Sequencing Primer
(F):5'- atttgagtgctgccccc -3'
(R):5'- ACTGGTGCCCAGGAGAC -3'
Posted On2014-01-29