Incidental Mutation 'R1247:Huwe1'
ID152174
Institutional Source Beutler Lab
Gene Symbol Huwe1
Ensembl Gene ENSMUSG00000025261
Gene NameHECT, UBA and WWE domain containing 1
SynonymsLOC382250, C430014N20Rik, Ib772, Ureb1, Mule, Arf-bp1, 5430439H10Rik
MMRRC Submission 039314-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1247 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location151800807-151935417 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 151901570 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 2199 (S2199T)
Ref Sequence ENSEMBL: ENSMUSP00000108241 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026292] [ENSMUST00000112622]
Predicted Effect probably benign
Transcript: ENSMUST00000026292
AA Change: S2200T

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000026292
Gene: ENSMUSG00000025261
AA Change: S2200T

DomainStartEndE-ValueType
Pfam:DUF908 90 369 4.2e-38 PFAM
Pfam:DUF913 430 814 6.1e-121 PFAM
low complexity region 841 858 N/A INTRINSIC
low complexity region 887 901 N/A INTRINSIC
low complexity region 1052 1066 N/A INTRINSIC
low complexity region 1083 1104 N/A INTRINSIC
low complexity region 1292 1314 N/A INTRINSIC
UBA 1318 1354 1.3e-4 SMART
low complexity region 1397 1424 N/A INTRINSIC
low complexity region 1526 1542 N/A INTRINSIC
Pfam:WWE 1614 1679 3.5e-16 PFAM
low complexity region 1699 1710 N/A INTRINSIC
low complexity region 1841 1864 N/A INTRINSIC
low complexity region 2021 2036 N/A INTRINSIC
low complexity region 2053 2064 N/A INTRINSIC
low complexity region 2131 2143 N/A INTRINSIC
low complexity region 2262 2272 N/A INTRINSIC
low complexity region 2276 2293 N/A INTRINSIC
low complexity region 2348 2358 N/A INTRINSIC
low complexity region 2409 2471 N/A INTRINSIC
low complexity region 2527 2543 N/A INTRINSIC
low complexity region 2591 2601 N/A INTRINSIC
low complexity region 2679 2702 N/A INTRINSIC
low complexity region 2739 2759 N/A INTRINSIC
low complexity region 2766 2781 N/A INTRINSIC
low complexity region 2914 2933 N/A INTRINSIC
low complexity region 2945 2960 N/A INTRINSIC
Pfam:DUF4414 2969 3080 1.3e-32 PFAM
low complexity region 3091 3108 N/A INTRINSIC
low complexity region 3173 3182 N/A INTRINSIC
low complexity region 3224 3239 N/A INTRINSIC
low complexity region 3254 3264 N/A INTRINSIC
low complexity region 3370 3384 N/A INTRINSIC
low complexity region 3446 3461 N/A INTRINSIC
low complexity region 3476 3553 N/A INTRINSIC
low complexity region 3750 3762 N/A INTRINSIC
coiled coil region 3763 3787 N/A INTRINSIC
low complexity region 3838 3860 N/A INTRINSIC
low complexity region 3919 3935 N/A INTRINSIC
HECTc 4040 4378 2.28e-196 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112622
AA Change: S2199T

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000108241
Gene: ENSMUSG00000025261
AA Change: S2199T

DomainStartEndE-ValueType
Pfam:DUF908 89 370 1.8e-74 PFAM
Pfam:DUF913 429 815 1.2e-126 PFAM
low complexity region 841 858 N/A INTRINSIC
low complexity region 887 901 N/A INTRINSIC
low complexity region 1052 1066 N/A INTRINSIC
low complexity region 1083 1104 N/A INTRINSIC
low complexity region 1292 1314 N/A INTRINSIC
UBA 1318 1354 1.3e-4 SMART
low complexity region 1397 1424 N/A INTRINSIC
low complexity region 1526 1542 N/A INTRINSIC
Pfam:WWE 1611 1679 3.5e-14 PFAM
low complexity region 1699 1710 N/A INTRINSIC
low complexity region 1841 1864 N/A INTRINSIC
low complexity region 2052 2063 N/A INTRINSIC
low complexity region 2130 2142 N/A INTRINSIC
low complexity region 2261 2271 N/A INTRINSIC
low complexity region 2275 2292 N/A INTRINSIC
low complexity region 2347 2357 N/A INTRINSIC
low complexity region 2408 2470 N/A INTRINSIC
low complexity region 2526 2542 N/A INTRINSIC
low complexity region 2590 2600 N/A INTRINSIC
low complexity region 2678 2701 N/A INTRINSIC
low complexity region 2738 2758 N/A INTRINSIC
low complexity region 2765 2780 N/A INTRINSIC
low complexity region 2913 2932 N/A INTRINSIC
low complexity region 2944 2959 N/A INTRINSIC
Pfam:DUF4414 2968 3079 1.1e-34 PFAM
low complexity region 3090 3107 N/A INTRINSIC
low complexity region 3172 3181 N/A INTRINSIC
low complexity region 3223 3238 N/A INTRINSIC
low complexity region 3253 3263 N/A INTRINSIC
low complexity region 3369 3383 N/A INTRINSIC
low complexity region 3445 3460 N/A INTRINSIC
low complexity region 3475 3552 N/A INTRINSIC
low complexity region 3749 3761 N/A INTRINSIC
coiled coil region 3762 3786 N/A INTRINSIC
low complexity region 3837 3859 N/A INTRINSIC
low complexity region 3918 3934 N/A INTRINSIC
HECTc 4039 4377 2.28e-196 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150426
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a C-terminal HECT (E6AP type E3 ubiquitin protein ligase) domain that functions as an E3 ubiquitin ligase. The encoded protein is required for the ubiquitination and subsequent degradation of the anti-apoptotic protein Mcl1 (myeloid cell leukemia sequence 1 (BCL2-related)). This protein also ubiquitinates the p53 tumor suppressor, core histones, and DNA polymerase beta. Mutations in this gene are associated with Turner type X-linked syndromic mental retardation. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a conditional allele activated in neurons results in neonatal lethality, poorly developed dentate gyrus, small cerebellum, increased cortex density, and increased neuronal precursor cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 11 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930527J03Rik ACCC ACC 1: 178,276,503 noncoding transcript Het
Brca2 C A 5: 150,541,274 A1501D probably damaging Het
Ctbp2 G C 7: 132,995,189 R722G probably benign Het
Cyp3a44 A G 5: 145,791,667 F249S probably damaging Het
Pds5b CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 5: 150,775,354 probably benign Het
Samd4 AGG AG 14: 47,064,328 probably benign Het
Samd4 G GAAA 14: 47,087,758 probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Sox15 T C 11: 69,656,494 F190S probably benign Het
Syne2 G A 12: 75,967,490 A3153T probably benign Het
Tbr1 C T 2: 61,811,618 P409L possibly damaging Het
Other mutations in Huwe1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Huwe1 APN X 151885627 missense probably damaging 1.00
IGL00707:Huwe1 APN X 151860734 missense probably damaging 1.00
IGL00932:Huwe1 APN X 151860161 splice site probably benign
IGL01413:Huwe1 APN X 151882680 missense possibly damaging 0.48
IGL01685:Huwe1 APN X 151898670 splice site probably benign
IGL02120:Huwe1 APN X 151907390 missense possibly damaging 0.53
IGL02176:Huwe1 APN X 151903968 missense possibly damaging 0.47
IGL02868:Huwe1 APN X 151908833 missense possibly damaging 0.91
IGL02902:Huwe1 APN X 151886766 missense probably damaging 0.98
IGL02971:Huwe1 APN X 151927626 splice site probably benign
R0650:Huwe1 UTSW X 151876313 missense probably damaging 1.00
R0651:Huwe1 UTSW X 151876313 missense probably damaging 1.00
R0657:Huwe1 UTSW X 151919928 missense probably benign 0.33
R1241:Huwe1 UTSW X 151907048 small deletion probably benign
R1791:Huwe1 UTSW X 151864753 missense probably benign 0.06
R4296:Huwe1 UTSW X 151888448 missense probably benign 0.20
R4561:Huwe1 UTSW X 151863959 missense probably damaging 1.00
R4562:Huwe1 UTSW X 151863959 missense probably damaging 1.00
R4563:Huwe1 UTSW X 151863959 missense probably damaging 1.00
R5339:Huwe1 UTSW X 151907048 small deletion probably benign
Z1176:Huwe1 UTSW X 151856575 missense probably damaging 1.00
Z1176:Huwe1 UTSW X 151928381 missense unknown
Predicted Primers PCR Primer
(F):5'- GGTAAAAGCCCATGTCTGGCCTAGT -3'
(R):5'- GGCTAAATTACACTGCAAGGCAGC -3'

Sequencing Primer
(F):5'- GAACAAGAGTTGTGTTCACACC -3'
(R):5'- TGTAGAAAAGCAGTCATCATTTCAG -3'
Posted On2014-01-29