Incidental Mutation 'R1248:Retreg2'
ID152175
Institutional Source Beutler Lab
Gene Symbol Retreg2
Ensembl Gene ENSMUSG00000049339
Gene Namereticulophagy regulator family member 2
SynonymsMGC47289, Fam134a
MMRRC Submission 039315-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R1248 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location75142778-75147913 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 75145111 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041213] [ENSMUST00000097694] [ENSMUST00000168720] [ENSMUST00000187901] [ENSMUST00000188873] [ENSMUST00000189403] [ENSMUST00000189650] [ENSMUST00000189809] [ENSMUST00000190240] [ENSMUST00000190679]
Predicted Effect probably benign
Transcript: ENSMUST00000041213
SMART Domains Protein: ENSMUSP00000044799
Gene: ENSMUSG00000033159

DomainStartEndE-ValueType
Pfam:Cyclin 72 174 7.5e-10 PFAM
low complexity region 231 252 N/A INTRINSIC
low complexity region 256 268 N/A INTRINSIC
low complexity region 310 331 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097694
SMART Domains Protein: ENSMUSP00000095300
Gene: ENSMUSG00000049339

DomainStartEndE-ValueType
low complexity region 1 28 N/A INTRINSIC
low complexity region 34 43 N/A INTRINSIC
low complexity region 84 114 N/A INTRINSIC
transmembrane domain 198 220 N/A INTRINSIC
low complexity region 269 283 N/A INTRINSIC
low complexity region 453 491 N/A INTRINSIC
low complexity region 506 520 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168720
SMART Domains Protein: ENSMUSP00000132688
Gene: ENSMUSG00000033159

DomainStartEndE-ValueType
Pfam:Cyclin 49 174 5.2e-13 PFAM
Pfam:Cyclin_N 55 175 4.4e-6 PFAM
low complexity region 231 252 N/A INTRINSIC
low complexity region 256 268 N/A INTRINSIC
low complexity region 310 331 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186037
Predicted Effect probably benign
Transcript: ENSMUST00000187901
SMART Domains Protein: ENSMUSP00000140636
Gene: ENSMUSG00000049339

DomainStartEndE-ValueType
low complexity region 12 39 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188873
SMART Domains Protein: ENSMUSP00000139508
Gene: ENSMUSG00000049339

DomainStartEndE-ValueType
low complexity region 1 28 N/A INTRINSIC
low complexity region 34 43 N/A INTRINSIC
low complexity region 84 114 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188977
Predicted Effect probably benign
Transcript: ENSMUST00000189345
Predicted Effect probably benign
Transcript: ENSMUST00000189403
SMART Domains Protein: ENSMUSP00000141062
Gene: ENSMUSG00000033159

DomainStartEndE-ValueType
Pfam:Cyclin 44 170 1.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189650
SMART Domains Protein: ENSMUSP00000139473
Gene: ENSMUSG00000049339

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 45 75 N/A INTRINSIC
low complexity region 123 134 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189809
SMART Domains Protein: ENSMUSP00000140262
Gene: ENSMUSG00000033159

DomainStartEndE-ValueType
Blast:CYCLIN 81 114 1e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000190240
SMART Domains Protein: ENSMUSP00000139410
Gene: ENSMUSG00000049339

DomainStartEndE-ValueType
low complexity region 1 28 N/A INTRINSIC
low complexity region 34 43 N/A INTRINSIC
Pfam:Reticulon 65 231 1.4e-8 PFAM
low complexity region 269 283 N/A INTRINSIC
low complexity region 435 454 N/A INTRINSIC
low complexity region 469 483 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190679
SMART Domains Protein: ENSMUSP00000140289
Gene: ENSMUSG00000033159

DomainStartEndE-ValueType
Pfam:Cyclin 49 174 5.2e-13 PFAM
Pfam:Cyclin_N 55 175 4.4e-6 PFAM
low complexity region 231 252 N/A INTRINSIC
low complexity region 256 268 N/A INTRINSIC
low complexity region 310 331 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.5%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb A T 10: 10,395,310 F863Y probably damaging Het
Akap12 A G 10: 4,353,847 E219G probably benign Het
Akr1c20 G A 13: 4,514,400 T38I possibly damaging Het
Ap5z1 C A 5: 142,474,500 S511R probably benign Het
Arhgap11a T A 2: 113,834,102 H612L possibly damaging Het
Atp2b2 G T 6: 113,817,192 S118Y probably damaging Het
Boc A T 16: 44,520,473 M38K probably benign Het
Ccdc171 A T 4: 83,681,244 E773D possibly damaging Het
Dmtn C T 14: 70,612,658 probably benign Het
Dnah10 G A 5: 124,755,823 probably benign Het
Efcab1 A G 16: 14,924,137 M212V probably benign Het
Fam83b T C 9: 76,503,076 N184S probably benign Het
Fam98c A G 7: 29,152,840 M98T probably damaging Het
Fbn1 T C 2: 125,301,609 K2867E probably benign Het
Fsip2 A T 2: 82,989,763 E5280V possibly damaging Het
Fuom T C 7: 140,099,718 probably benign Het
Gm3476 A T 14: 6,118,512 S204T probably benign Het
Grhl3 A G 4: 135,561,306 F23L probably benign Het
Il4i1 G T 7: 44,839,789 R334L probably damaging Het
Ipo13 A G 4: 117,901,031 S712P probably damaging Het
Lama4 G T 10: 39,056,847 S573I probably damaging Het
Lrp11 A G 10: 7,604,294 H371R probably benign Het
Mkln1 T A 6: 31,489,368 I520N probably damaging Het
Nagpa G T 16: 5,198,616 C236* probably null Het
Nktr A G 9: 121,727,370 N38S probably damaging Het
Nlrp10 G A 7: 108,925,881 R131C probably benign Het
Nxpe2 T C 9: 48,319,911 D386G possibly damaging Het
Prpf39 T A 12: 65,053,966 probably benign Het
S100a4 G T 3: 90,605,777 S60I possibly damaging Het
Slc12a3 G T 8: 94,333,277 G184C probably damaging Het
Slc25a46 C T 18: 31,609,754 D20N possibly damaging Het
Smc3 A G 19: 53,634,078 K695E probably benign Het
Speer2 A T 16: 69,857,067 probably null Het
Taar4 T G 10: 23,961,038 V182G possibly damaging Het
Ttll1 C G 15: 83,502,125 S93T probably benign Het
Ubl3 A T 5: 148,506,198 probably null Het
Vmn2r16 A G 5: 109,360,777 N457S probably benign Het
Vmn2r72 T C 7: 85,749,188 E528G probably benign Het
Zfp52 A C 17: 21,560,049 E53A probably damaging Het
Other mutations in Retreg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01431:Retreg2 APN 1 75145105 critical splice donor site probably null
IGL01625:Retreg2 APN 1 75144715 unclassified probably benign
R0143:Retreg2 UTSW 1 75146430 missense possibly damaging 0.82
R1446:Retreg2 UTSW 1 75143459 missense possibly damaging 0.69
R1463:Retreg2 UTSW 1 75146520 missense probably damaging 0.98
R1734:Retreg2 UTSW 1 75142986 splice site probably null
R1851:Retreg2 UTSW 1 75146675 missense probably benign 0.00
R1852:Retreg2 UTSW 1 75146675 missense probably benign 0.00
R2883:Retreg2 UTSW 1 75146712 missense probably benign 0.01
R3027:Retreg2 UTSW 1 75146444 missense probably damaging 0.99
R4665:Retreg2 UTSW 1 75144666 missense probably damaging 1.00
R5497:Retreg2 UTSW 1 75144989 missense probably damaging 1.00
R5544:Retreg2 UTSW 1 75144689 makesense probably null
R6143:Retreg2 UTSW 1 75146886 missense probably damaging 1.00
R6881:Retreg2 UTSW 1 75146439 missense probably damaging 1.00
R7576:Retreg2 UTSW 1 75144688 missense probably damaging 0.99
R7822:Retreg2 UTSW 1 75146541 missense possibly damaging 0.63
Z1176:Retreg2 UTSW 1 75145743 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACAGTTTGGATGAAGGCTCCTGAG -3'
(R):5'- TCCACCTGCAAGAGAACCAGGATG -3'

Sequencing Primer
(F):5'- GGCTCCTGAGAAAGTGGC -3'
(R):5'- tccttctgcttcctcctctc -3'
Posted On2014-01-29