Incidental Mutation 'R1248:S100a4'
ID152179
Institutional Source Beutler Lab
Gene Symbol S100a4
Ensembl Gene ENSMUSG00000001020
Gene NameS100 calcium binding protein A4
SynonymsMts1, metastasin, 42a, 18A2, FSp1, PeL98, CAPL, calvasculin, Capl, pk9a
MMRRC Submission 039315-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.253) question?
Stock #R1248 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location90603771-90606045 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 90605777 bp
ZygosityHeterozygous
Amino Acid Change Serine to Isoleucine at position 60 (S60I)
Ref Sequence ENSEMBL: ENSMUSP00000001046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001046] [ENSMUST00000001047] [ENSMUST00000001049] [ENSMUST00000107329] [ENSMUST00000142476] [ENSMUST00000200290] [ENSMUST00000200508]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001046
AA Change: S60I

PolyPhen 2 Score 0.855 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000001046
Gene: ENSMUSG00000001020
AA Change: S60I

DomainStartEndE-ValueType
Pfam:S_100 5 48 2.1e-23 PFAM
Blast:EFh 54 82 6e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000001047
SMART Domains Protein: ENSMUSP00000001047
Gene: ENSMUSG00000001021

DomainStartEndE-ValueType
Pfam:S_100 5 46 4e-19 PFAM
Blast:EFh 54 82 2e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000001049
SMART Domains Protein: ENSMUSP00000001049
Gene: ENSMUSG00000001023

DomainStartEndE-ValueType
Pfam:S_100 5 43 1.7e-18 PFAM
Blast:EFh 52 80 2e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000107329
SMART Domains Protein: ENSMUSP00000102952
Gene: ENSMUSG00000001023

DomainStartEndE-ValueType
Pfam:S_100 5 45 6.1e-20 PFAM
Blast:EFh 52 80 2e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000107330
SMART Domains Protein: ENSMUSP00000102953
Gene: ENSMUSG00000105518

DomainStartEndE-ValueType
Pfam:S_100 5 47 4.3e-23 PFAM
Blast:EFh 54 82 6e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000142476
AA Change: S60I

PolyPhen 2 Score 0.180 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000143522
Gene: ENSMUSG00000001020
AA Change: S60I

DomainStartEndE-ValueType
Pfam:S_100 5 47 1.9e-20 PFAM
Blast:EFh 54 78 2e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196635
Predicted Effect probably benign
Transcript: ENSMUST00000200290
SMART Domains Protein: ENSMUSP00000142334
Gene: ENSMUSG00000001021

DomainStartEndE-ValueType
Pfam:S_100 5 48 1.9e-20 PFAM
Blast:EFh 54 82 2e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000200508
SMART Domains Protein: ENSMUSP00000142747
Gene: ENSMUSG00000001021

DomainStartEndE-ValueType
Pfam:S_100 5 48 1.9e-20 PFAM
Blast:EFh 54 82 2e-6 BLAST
Meta Mutation Damage Score 0.0926 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.5%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21. This protein may function in motility, invasion, and tubulin polymerization. Chromosomal rearrangements and altered expression of this gene have been implicated in tumor metastasis. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one knock-out allele exhibit impaired chemotaxis of macrophages. Mice homozygous for another knock-out allele exhibit embryonic lethality resulting in a skewed sex ratio and increased tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb A T 10: 10,395,310 F863Y probably damaging Het
Akap12 A G 10: 4,353,847 E219G probably benign Het
Akr1c20 G A 13: 4,514,400 T38I possibly damaging Het
Ap5z1 C A 5: 142,474,500 S511R probably benign Het
Arhgap11a T A 2: 113,834,102 H612L possibly damaging Het
Atp2b2 G T 6: 113,817,192 S118Y probably damaging Het
Boc A T 16: 44,520,473 M38K probably benign Het
Ccdc171 A T 4: 83,681,244 E773D possibly damaging Het
Dmtn C T 14: 70,612,658 probably benign Het
Dnah10 G A 5: 124,755,823 probably benign Het
Efcab1 A G 16: 14,924,137 M212V probably benign Het
Fam83b T C 9: 76,503,076 N184S probably benign Het
Fam98c A G 7: 29,152,840 M98T probably damaging Het
Fbn1 T C 2: 125,301,609 K2867E probably benign Het
Fsip2 A T 2: 82,989,763 E5280V possibly damaging Het
Fuom T C 7: 140,099,718 probably benign Het
Gm3476 A T 14: 6,118,512 S204T probably benign Het
Grhl3 A G 4: 135,561,306 F23L probably benign Het
Il4i1 G T 7: 44,839,789 R334L probably damaging Het
Ipo13 A G 4: 117,901,031 S712P probably damaging Het
Lama4 G T 10: 39,056,847 S573I probably damaging Het
Lrp11 A G 10: 7,604,294 H371R probably benign Het
Mkln1 T A 6: 31,489,368 I520N probably damaging Het
Nagpa G T 16: 5,198,616 C236* probably null Het
Nktr A G 9: 121,727,370 N38S probably damaging Het
Nlrp10 G A 7: 108,925,881 R131C probably benign Het
Nxpe2 T C 9: 48,319,911 D386G possibly damaging Het
Prpf39 T A 12: 65,053,966 probably benign Het
Retreg2 A G 1: 75,145,111 probably benign Het
Slc12a3 G T 8: 94,333,277 G184C probably damaging Het
Slc25a46 C T 18: 31,609,754 D20N possibly damaging Het
Smc3 A G 19: 53,634,078 K695E probably benign Het
Speer2 A T 16: 69,857,067 probably null Het
Taar4 T G 10: 23,961,038 V182G possibly damaging Het
Ttll1 C G 15: 83,502,125 S93T probably benign Het
Ubl3 A T 5: 148,506,198 probably null Het
Vmn2r16 A G 5: 109,360,777 N457S probably benign Het
Vmn2r72 T C 7: 85,749,188 E528G probably benign Het
Zfp52 A C 17: 21,560,049 E53A probably damaging Het
Other mutations in S100a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3814:S100a4 UTSW 3 90605845 missense probably benign 0.39
R8822:S100a4 UTSW 3 90605051 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- GTGTTCATCCCATAGTTTAGCCCCG -3'
(R):5'- TCCAGGTCAACTTCCAGCAGTCTC -3'

Sequencing Primer
(F):5'- TGCTTGCAAACCTTCCTGAG -3'
(R):5'- AGTAAGGCACTATGCTCACAG -3'
Posted On2014-01-29