Incidental Mutation 'R1248:Ap5z1'
ID152184
Institutional Source Beutler Lab
Gene Symbol Ap5z1
Ensembl Gene ENSMUSG00000039623
Gene Nameadaptor-related protein complex 5, zeta 1 subunit
SynonymsC330006K01Rik
MMRRC Submission 039315-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock #R1248 (G1)
Quality Score184
Status Validated
Chromosome5
Chromosomal Location142463944-142478710 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 142474500 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 511 (S511R)
Ref Sequence ENSEMBL: ENSMUSP00000143179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038699] [ENSMUST00000196055]
Predicted Effect probably benign
Transcript: ENSMUST00000038699
AA Change: S527R

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000041863
Gene: ENSMUSG00000039623
AA Change: S527R

DomainStartEndE-ValueType
low complexity region 271 294 N/A INTRINSIC
Pfam:SPG48 319 437 2.9e-45 PFAM
low complexity region 579 584 N/A INTRINSIC
low complexity region 617 628 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196055
AA Change: S511R

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000143179
Gene: ENSMUSG00000039623
AA Change: S511R

DomainStartEndE-ValueType
low complexity region 271 294 N/A INTRINSIC
Pfam:SPG48 318 758 2.6e-181 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196405
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197293
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198135
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.5%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by genome-wide screen for genes involved in homologous recombination DNA double-strand break repair (HR-DSBR). The encoded protein was found in a complex with other proteins that have a role in HR-DSBR. Knockdown of this gene reduced homologous recombination, and mutations in this gene were found in patients with spastic paraplegia. It was concluded that this gene likely encodes a helicase (PMID:20613862). [provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb A T 10: 10,395,310 F863Y probably damaging Het
Akap12 A G 10: 4,353,847 E219G probably benign Het
Akr1c20 G A 13: 4,514,400 T38I possibly damaging Het
Arhgap11a T A 2: 113,834,102 H612L possibly damaging Het
Atp2b2 G T 6: 113,817,192 S118Y probably damaging Het
Boc A T 16: 44,520,473 M38K probably benign Het
Ccdc171 A T 4: 83,681,244 E773D possibly damaging Het
Dmtn C T 14: 70,612,658 probably benign Het
Dnah10 G A 5: 124,755,823 probably benign Het
Efcab1 A G 16: 14,924,137 M212V probably benign Het
Fam83b T C 9: 76,503,076 N184S probably benign Het
Fam98c A G 7: 29,152,840 M98T probably damaging Het
Fbn1 T C 2: 125,301,609 K2867E probably benign Het
Fsip2 A T 2: 82,989,763 E5280V possibly damaging Het
Fuom T C 7: 140,099,718 probably benign Het
Gm3476 A T 14: 6,118,512 S204T probably benign Het
Grhl3 A G 4: 135,561,306 F23L probably benign Het
Il4i1 G T 7: 44,839,789 R334L probably damaging Het
Ipo13 A G 4: 117,901,031 S712P probably damaging Het
Lama4 G T 10: 39,056,847 S573I probably damaging Het
Lrp11 A G 10: 7,604,294 H371R probably benign Het
Mkln1 T A 6: 31,489,368 I520N probably damaging Het
Nagpa G T 16: 5,198,616 C236* probably null Het
Nktr A G 9: 121,727,370 N38S probably damaging Het
Nlrp10 G A 7: 108,925,881 R131C probably benign Het
Nxpe2 T C 9: 48,319,911 D386G possibly damaging Het
Prpf39 T A 12: 65,053,966 probably benign Het
Retreg2 A G 1: 75,145,111 probably benign Het
S100a4 G T 3: 90,605,777 S60I possibly damaging Het
Slc12a3 G T 8: 94,333,277 G184C probably damaging Het
Slc25a46 C T 18: 31,609,754 D20N possibly damaging Het
Smc3 A G 19: 53,634,078 K695E probably benign Het
Speer2 A T 16: 69,857,067 probably null Het
Taar4 T G 10: 23,961,038 V182G possibly damaging Het
Ttll1 C G 15: 83,502,125 S93T probably benign Het
Ubl3 A T 5: 148,506,198 probably null Het
Vmn2r16 A G 5: 109,360,777 N457S probably benign Het
Vmn2r72 T C 7: 85,749,188 E528G probably benign Het
Zfp52 A C 17: 21,560,049 E53A probably damaging Het
Other mutations in Ap5z1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Ap5z1 APN 5 142472251 missense probably benign 0.02
IGL01456:Ap5z1 APN 5 142468036 missense probably damaging 0.96
IGL01656:Ap5z1 APN 5 142470314 missense probably benign 0.10
IGL02079:Ap5z1 APN 5 142477113 critical splice donor site probably null
IGL02134:Ap5z1 APN 5 142474459 missense probably benign 0.09
IGL02662:Ap5z1 APN 5 142476889 splice site probably null
IGL02805:Ap5z1 APN 5 142470283 unclassified probably benign
R0057:Ap5z1 UTSW 5 142470389 unclassified probably benign
R0057:Ap5z1 UTSW 5 142470389 unclassified probably benign
R0094:Ap5z1 UTSW 5 142476812 missense probably benign 0.00
R0395:Ap5z1 UTSW 5 142470562 unclassified probably benign
R0811:Ap5z1 UTSW 5 142475791 missense probably benign 0.00
R0812:Ap5z1 UTSW 5 142475791 missense probably benign 0.00
R1241:Ap5z1 UTSW 5 142470114 missense probably damaging 1.00
R1374:Ap5z1 UTSW 5 142470458 missense probably damaging 1.00
R1616:Ap5z1 UTSW 5 142472236 missense probably benign 0.10
R1923:Ap5z1 UTSW 5 142472341 missense probably benign 0.30
R2423:Ap5z1 UTSW 5 142476777 missense probably benign 0.02
R3790:Ap5z1 UTSW 5 142470413 missense probably benign
R4859:Ap5z1 UTSW 5 142473993 missense possibly damaging 0.75
R4965:Ap5z1 UTSW 5 142467676 missense probably damaging 1.00
R5147:Ap5z1 UTSW 5 142466510 missense probably benign 0.02
R5311:Ap5z1 UTSW 5 142467687 missense possibly damaging 0.79
R5531:Ap5z1 UTSW 5 142467781 missense probably benign
R5569:Ap5z1 UTSW 5 142474451 missense probably damaging 0.99
R5725:Ap5z1 UTSW 5 142468976 missense probably damaging 1.00
R7287:Ap5z1 UTSW 5 142474047 missense probably damaging 0.99
R7407:Ap5z1 UTSW 5 142466575 missense probably benign 0.06
R7537:Ap5z1 UTSW 5 142477298 missense probably benign 0.06
R7894:Ap5z1 UTSW 5 142466284 missense probably benign 0.34
R7894:Ap5z1 UTSW 5 142470436 nonsense probably null
R7895:Ap5z1 UTSW 5 142470558 critical splice donor site probably null
R8022:Ap5z1 UTSW 5 142470149 critical splice donor site probably null
R8244:Ap5z1 UTSW 5 142473980 missense possibly damaging 0.60
R8823:Ap5z1 UTSW 5 142474436 missense probably benign 0.19
R8867:Ap5z1 UTSW 5 142477256 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGACTTGTGCTAAGAGCTGCATCC -3'
(R):5'- AGCCTGGAGACACAATAGGGCTAC -3'

Sequencing Primer
(F):5'- TAAGAGCTGCATCCCAGCC -3'
(R):5'- TTGGGATCACACGTACCAAG -3'
Posted On2014-01-29