Incidental Mutation 'R1248:Fam98c'
ID152188
Institutional Source Beutler Lab
Gene Symbol Fam98c
Ensembl Gene ENSMUSG00000030590
Gene Namefamily with sequence similarity 98, member C
Synonyms
MMRRC Submission 039315-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R1248 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location29152510-29156234 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29152840 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 98 (M98T)
Ref Sequence ENSEMBL: ENSMUSP00000120165 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032811] [ENSMUST00000094617] [ENSMUST00000123416] [ENSMUST00000134176] [ENSMUST00000159351] [ENSMUST00000159975] [ENSMUST00000160194] [ENSMUST00000160396] [ENSMUST00000161522] [ENSMUST00000164589] [ENSMUST00000205027] [ENSMUST00000204194] [ENSMUST00000203070] [ENSMUST00000203380] [ENSMUST00000204845]
Predicted Effect probably benign
Transcript: ENSMUST00000032811
SMART Domains Protein: ENSMUSP00000032811
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Blast:RasGEFN 66 162 1e-30 BLAST
low complexity region 163 188 N/A INTRINSIC
RasGEF 197 433 2.92e-70 SMART
C1 541 590 4.12e-12 SMART
low complexity region 600 609 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094617
SMART Domains Protein: ENSMUSP00000092200
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Blast:RasGEFN 66 163 2e-29 BLAST
low complexity region 164 189 N/A INTRINSIC
RasGEF 198 434 2.92e-70 SMART
C1 542 596 1.81e-8 SMART
low complexity region 606 615 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123416
SMART Domains Protein: ENSMUSP00000122992
Gene: ENSMUSG00000030590

DomainStartEndE-ValueType
Pfam:DUF2465 6 125 8.9e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123545
Predicted Effect probably damaging
Transcript: ENSMUST00000134176
AA Change: M98T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000120165
Gene: ENSMUSG00000030590
AA Change: M98T

DomainStartEndE-ValueType
Pfam:DUF2465 1 125 5.9e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138084
Predicted Effect unknown
Transcript: ENSMUST00000144795
AA Change: M214T
SMART Domains Protein: ENSMUSP00000121796
Gene: ENSMUSG00000030590
AA Change: M214T

DomainStartEndE-ValueType
Pfam:DUF2465 5 175 1.7e-30 PFAM
Pfam:DUF2465 172 213 1.3e-14 PFAM
Pfam:DUF2465 211 242 6.9e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147561
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150431
Predicted Effect unknown
Transcript: ENSMUST00000153251
AA Change: M168T
SMART Domains Protein: ENSMUSP00000117500
Gene: ENSMUSG00000030590
AA Change: M168T

DomainStartEndE-ValueType
Pfam:DUF2465 1 114 1.9e-22 PFAM
Pfam:DUF2465 111 196 1.1e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159351
SMART Domains Protein: ENSMUSP00000124183
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Blast:RasGEFN 66 162 7e-31 BLAST
low complexity region 163 188 N/A INTRINSIC
RasGEF 197 433 2.92e-70 SMART
Blast:RasGEF 449 553 7e-25 BLAST
SCOP:d1ptq__ 541 573 1e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159898
Predicted Effect probably benign
Transcript: ENSMUST00000159975
SMART Domains Protein: ENSMUSP00000125137
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Blast:RasGEFN 66 162 1e-30 BLAST
low complexity region 163 188 N/A INTRINSIC
RasGEF 197 433 2.92e-70 SMART
C1 541 595 1.81e-8 SMART
low complexity region 605 614 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160194
SMART Domains Protein: ENSMUSP00000124908
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Blast:RasGEFN 66 162 8e-32 BLAST
low complexity region 163 188 N/A INTRINSIC
RasGEF 197 423 6.73e-61 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160396
Predicted Effect probably benign
Transcript: ENSMUST00000161522
SMART Domains Protein: ENSMUSP00000123718
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Blast:RasGEFN 66 165 7e-32 BLAST
RasGEF 183 419 2.92e-70 SMART
C1 527 576 4.12e-12 SMART
low complexity region 586 595 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162946
Predicted Effect probably damaging
Transcript: ENSMUST00000164589
AA Change: M300T

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131477
Gene: ENSMUSG00000030590
AA Change: M300T

DomainStartEndE-ValueType
Pfam:DUF2465 8 327 3.8e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205027
SMART Domains Protein: ENSMUSP00000145186
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
RasGEFN 48 172 2.6e-3 SMART
C1 352 401 2.1e-14 SMART
low complexity region 411 420 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204194
SMART Domains Protein: ENSMUSP00000145259
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
RasGEFN 48 172 2.6e-3 SMART
RasGEF 85 336 1e-7 SMART
C1 444 493 2.1e-14 SMART
low complexity region 503 512 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184073
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205672
Predicted Effect probably benign
Transcript: ENSMUST00000203070
SMART Domains Protein: ENSMUSP00000145352
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
RasGEFN 48 172 2.6e-3 SMART
RasGEF 197 504 1.8e-20 SMART
C1 449 498 2.1e-14 SMART
low complexity region 508 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203380
SMART Domains Protein: ENSMUSP00000144753
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
RasGEFN 48 172 2.6e-3 SMART
RasGEF 197 364 3e-25 SMART
C1 472 521 2.1e-14 SMART
low complexity region 531 540 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204845
SMART Domains Protein: ENSMUSP00000144774
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
RasGEFN 48 172 2.6e-3 SMART
RasGEF 197 399 8.7e-49 SMART
C1 507 556 2.1e-14 SMART
low complexity region 566 575 N/A INTRINSIC
Meta Mutation Damage Score 0.6799 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.5%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb A T 10: 10,395,310 F863Y probably damaging Het
Akap12 A G 10: 4,353,847 E219G probably benign Het
Akr1c20 G A 13: 4,514,400 T38I possibly damaging Het
Ap5z1 C A 5: 142,474,500 S511R probably benign Het
Arhgap11a T A 2: 113,834,102 H612L possibly damaging Het
Atp2b2 G T 6: 113,817,192 S118Y probably damaging Het
Boc A T 16: 44,520,473 M38K probably benign Het
Ccdc171 A T 4: 83,681,244 E773D possibly damaging Het
Dmtn C T 14: 70,612,658 probably benign Het
Dnah10 G A 5: 124,755,823 probably benign Het
Efcab1 A G 16: 14,924,137 M212V probably benign Het
Fam83b T C 9: 76,503,076 N184S probably benign Het
Fbn1 T C 2: 125,301,609 K2867E probably benign Het
Fsip2 A T 2: 82,989,763 E5280V possibly damaging Het
Fuom T C 7: 140,099,718 probably benign Het
Gm3476 A T 14: 6,118,512 S204T probably benign Het
Grhl3 A G 4: 135,561,306 F23L probably benign Het
Il4i1 G T 7: 44,839,789 R334L probably damaging Het
Ipo13 A G 4: 117,901,031 S712P probably damaging Het
Lama4 G T 10: 39,056,847 S573I probably damaging Het
Lrp11 A G 10: 7,604,294 H371R probably benign Het
Mkln1 T A 6: 31,489,368 I520N probably damaging Het
Nagpa G T 16: 5,198,616 C236* probably null Het
Nktr A G 9: 121,727,370 N38S probably damaging Het
Nlrp10 G A 7: 108,925,881 R131C probably benign Het
Nxpe2 T C 9: 48,319,911 D386G possibly damaging Het
Prpf39 T A 12: 65,053,966 probably benign Het
Retreg2 A G 1: 75,145,111 probably benign Het
S100a4 G T 3: 90,605,777 S60I possibly damaging Het
Slc12a3 G T 8: 94,333,277 G184C probably damaging Het
Slc25a46 C T 18: 31,609,754 D20N possibly damaging Het
Smc3 A G 19: 53,634,078 K695E probably benign Het
Speer2 A T 16: 69,857,067 probably null Het
Taar4 T G 10: 23,961,038 V182G possibly damaging Het
Ttll1 C G 15: 83,502,125 S93T probably benign Het
Ubl3 A T 5: 148,506,198 probably null Het
Vmn2r16 A G 5: 109,360,777 N457S probably benign Het
Vmn2r72 T C 7: 85,749,188 E528G probably benign Het
Zfp52 A C 17: 21,560,049 E53A probably damaging Het
Other mutations in Fam98c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Fam98c APN 7 29152853 unclassified probably benign
IGL02603:Fam98c APN 7 29154448 missense probably damaging 1.00
IGL02638:Fam98c APN 7 29152762 missense probably damaging 1.00
R0147:Fam98c UTSW 7 29152721 nonsense probably null
R4627:Fam98c UTSW 7 29155268 missense possibly damaging 0.71
R4628:Fam98c UTSW 7 29155268 missense possibly damaging 0.71
R4629:Fam98c UTSW 7 29155268 missense possibly damaging 0.71
R4688:Fam98c UTSW 7 29155241 missense probably damaging 1.00
R5247:Fam98c UTSW 7 29155701 missense possibly damaging 0.84
R6254:Fam98c UTSW 7 29154517 missense probably damaging 1.00
R6354:Fam98c UTSW 7 29152847 missense probably damaging 1.00
R6388:Fam98c UTSW 7 29155303 missense probably damaging 0.98
R6433:Fam98c UTSW 7 29156128 critical splice donor site probably null
R7058:Fam98c UTSW 7 29155883 critical splice donor site probably null
R7626:Fam98c UTSW 7 29152823 missense probably damaging 1.00
R8691:Fam98c UTSW 7 29153464 missense probably damaging 0.98
Z1186:Fam98c UTSW 7 29153458 missense probably benign 0.00
Z1186:Fam98c UTSW 7 29155767 missense probably benign
Z1186:Fam98c UTSW 7 29156140 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACACGGTTCATAGTGTTGAGTGGC -3'
(R):5'- AATCAACAAGGTGGGCACACCTGG -3'

Sequencing Primer
(F):5'- GGCATTTAGGGCCTCTAGAATAG -3'
(R):5'- atcctcctgccactgcc -3'
Posted On2014-01-29