Mutagenetix > Incidental Mutations

Incidental Mutation 'R1248:Vmn2r72'

152189

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r72

Ensembl Gene

ENSMUSG00000051877

Gene Name

vomeronasal 2, receptor 72

Synonyms

Vmn2r72-ps, EG244114

MMRRC Submission

039315-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.088) question?

Stock #

R1248 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

85737784-85754981 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 85749188 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 528 (E528G)

Ref Sequence

ENSEMBL: ENSMUSP00000133014 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000063425]

AlphaFold

D3Z4N8

Predicted Effect

probably benign
Transcript: ENSMUST00000063425
AA Change: E528G

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000133014
Gene: ENSMUSG00000051877
AA Change: E528G

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	82	469	2.3e-28	PFAM
Pfam:NCD3G	512	564	1.2e-18	PFAM
Pfam:7tm_3	594	832	4e-53	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.6%
20x: 90.5%

Validation Efficiency

98% (43/44)

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgb	A	T	10: 10,395,310	F863Y	probably damaging	Het
Akap12	A	G	10: 4,353,847	E219G	probably benign	Het
Akr1c20	G	A	13: 4,514,400	T38I	possibly damaging	Het
Ap5z1	C	A	5: 142,474,500	S511R	probably benign	Het
Arhgap11a	T	A	2: 113,834,102	H612L	possibly damaging	Het
Atp2b2	G	T	6: 113,817,192	S118Y	probably damaging	Het
Boc	A	T	16: 44,520,473	M38K	probably benign	Het
Ccdc171	A	T	4: 83,681,244	E773D	possibly damaging	Het
Dmtn	C	T	14: 70,612,658		probably benign	Het
Dnah10	G	A	5: 124,755,823		probably benign	Het
Efcab1	A	G	16: 14,924,137	M212V	probably benign	Het
Fam83b	T	C	9: 76,503,076	N184S	probably benign	Het
Fam98c	A	G	7: 29,152,840	M98T	probably damaging	Het
Fbn1	T	C	2: 125,301,609	K2867E	probably benign	Het
Fsip2	A	T	2: 82,989,763	E5280V	possibly damaging	Het
Fuom	T	C	7: 140,099,718		probably benign	Het
Gm3476	A	T	14: 6,118,512	S204T	probably benign	Het
Grhl3	A	G	4: 135,561,306	F23L	probably benign	Het
Il4i1	G	T	7: 44,839,789	R334L	probably damaging	Het
Ipo13	A	G	4: 117,901,031	S712P	probably damaging	Het
Lama4	G	T	10: 39,056,847	S573I	probably damaging	Het
Lrp11	A	G	10: 7,604,294	H371R	probably benign	Het
Mkln1	T	A	6: 31,489,368	I520N	probably damaging	Het
Nagpa	G	T	16: 5,198,616	C236*	probably null	Het
Nktr	A	G	9: 121,727,370	N38S	probably damaging	Het
Nlrp10	G	A	7: 108,925,881	R131C	probably benign	Het
Nxpe2	T	C	9: 48,319,911	D386G	possibly damaging	Het
Prpf39	T	A	12: 65,053,966		probably benign	Het
Retreg2	A	G	1: 75,145,111		probably benign	Het
S100a4	G	T	3: 90,605,777	S60I	possibly damaging	Het
Slc12a3	G	T	8: 94,333,277	G184C	probably damaging	Het
Slc25a46	C	T	18: 31,609,754	D20N	possibly damaging	Het
Smc3	A	G	19: 53,634,078	K695E	probably benign	Het
Speer2	A	T	16: 69,857,067		probably null	Het
Taar4	T	G	10: 23,961,038	V182G	possibly damaging	Het
Ttll1	C	G	15: 83,502,125	S93T	probably benign	Het
Ubl3	A	T	5: 148,506,198		probably null	Het
Vmn2r16	A	G	5: 109,360,777	N457S	probably benign	Het
Zfp52	A	C	17: 21,560,049	E53A	probably damaging	Het

Other mutations in Vmn2r72

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00931:Vmn2r72	APN	7	85749646	missense	probably benign	0.01
IGL01019:Vmn2r72	APN	7	85738334	missense	probably benign	0.26
IGL01445:Vmn2r72	APN	7	85749646	missense	probably benign	0.06
IGL02076:Vmn2r72	APN	7	85738367	missense	probably damaging	1.00
IGL02082:Vmn2r72	APN	7	85738166	missense	probably benign	0.00
IGL02086:Vmn2r72	APN	7	85738166	missense	probably benign	0.00
IGL02089:Vmn2r72	APN	7	85738166	missense	probably benign	0.00
IGL02125:Vmn2r72	APN	7	85750711	missense	probably benign	0.00
IGL02146:Vmn2r72	APN	7	85737962	missense	probably damaging	1.00
IGL02272:Vmn2r72	APN	7	85750693	missense	probably benign
IGL02514:Vmn2r72	APN	7	85738699	missense	possibly damaging	0.90
IGL02662:Vmn2r72	APN	7	85738183	missense	probably benign	0.26
IGL02697:Vmn2r72	APN	7	85738671	missense	probably benign	0.36
IGL02733:Vmn2r72	APN	7	85751813	missense	probably benign	0.05
IGL03070:Vmn2r72	APN	7	85752041	splice site	probably benign
IGL03150:Vmn2r72	APN	7	85751176	missense	probably damaging	1.00
IGL03159:Vmn2r72	APN	7	85754954	missense	probably benign	0.05
IGL03333:Vmn2r72	APN	7	85750867	missense	probably benign	0.10
R0081:Vmn2r72	UTSW	7	85751836	missense	probably benign	0.01
R0090:Vmn2r72	UTSW	7	85754876	missense	probably benign
R0655:Vmn2r72	UTSW	7	85738111	nonsense	probably null
R0778:Vmn2r72	UTSW	7	85749739	missense	probably benign	0.00
R1169:Vmn2r72	UTSW	7	85751309	missense	probably benign	0.01
R1172:Vmn2r72	UTSW	7	85751944	missense	probably damaging	1.00
R1173:Vmn2r72	UTSW	7	85751944	missense	probably damaging	1.00
R1175:Vmn2r72	UTSW	7	85751944	missense	probably damaging	1.00
R1302:Vmn2r72	UTSW	7	85738257	missense	probably damaging	1.00
R1506:Vmn2r72	UTSW	7	85749211	missense	probably benign
R1632:Vmn2r72	UTSW	7	85751792	missense	probably benign	0.13
R1775:Vmn2r72	UTSW	7	85738170	missense	probably benign	0.01
R1962:Vmn2r72	UTSW	7	85749161	missense	probably benign	0.00
R2201:Vmn2r72	UTSW	7	85738236	missense	probably benign	0.12
R2290:Vmn2r72	UTSW	7	85738341	missense	probably damaging	1.00
R2327:Vmn2r72	UTSW	7	85738256	missense	probably damaging	1.00
R2424:Vmn2r72	UTSW	7	85750953	missense	probably damaging	1.00
R2655:Vmn2r72	UTSW	7	85751269	missense	possibly damaging	0.95
R2860:Vmn2r72	UTSW	7	85750836	missense	probably damaging	0.99
R2861:Vmn2r72	UTSW	7	85750836	missense	probably damaging	0.99
R2862:Vmn2r72	UTSW	7	85750836	missense	probably damaging	0.99
R3009:Vmn2r72	UTSW	7	85749642	missense	probably benign	0.00
R3797:Vmn2r72	UTSW	7	85738077	missense	probably benign	0.44
R3798:Vmn2r72	UTSW	7	85738077	missense	probably benign	0.44
R3902:Vmn2r72	UTSW	7	85749735	missense	possibly damaging	0.52
R3959:Vmn2r72	UTSW	7	85751131	missense	probably benign	0.36
R3974:Vmn2r72	UTSW	7	85749809	missense	probably damaging	1.00
R4399:Vmn2r72	UTSW	7	85738500	missense	probably damaging	1.00
R4421:Vmn2r72	UTSW	7	85738500	missense	probably damaging	1.00
R4426:Vmn2r72	UTSW	7	85737828	nonsense	probably null
R4522:Vmn2r72	UTSW	7	85751926	missense	probably benign	0.44
R4523:Vmn2r72	UTSW	7	85751926	missense	probably benign	0.44
R4533:Vmn2r72	UTSW	7	85751926	missense	probably benign	0.44
R4691:Vmn2r72	UTSW	7	85737911	nonsense	probably null
R4781:Vmn2r72	UTSW	7	85737861	missense	probably benign	0.14
R4863:Vmn2r72	UTSW	7	85750598	missense	possibly damaging	0.91
R4952:Vmn2r72	UTSW	7	85751109	missense	probably benign
R4991:Vmn2r72	UTSW	7	85751130	missense	probably damaging	0.99
R4995:Vmn2r72	UTSW	7	85738485	missense	probably damaging	1.00
R5095:Vmn2r72	UTSW	7	85737853	missense	probably damaging	0.98
R5174:Vmn2r72	UTSW	7	85737840	missense	probably benign	0.00
R5276:Vmn2r72	UTSW	7	85738254	missense	possibly damaging	0.90
R5395:Vmn2r72	UTSW	7	85750897	missense	possibly damaging	0.71
R5560:Vmn2r72	UTSW	7	85751942	missense	probably damaging	0.96
R5933:Vmn2r72	UTSW	7	85737850	missense	probably benign	0.05
R6033:Vmn2r72	UTSW	7	85737929	missense	probably damaging	1.00
R6033:Vmn2r72	UTSW	7	85737929	missense	probably damaging	1.00
R6354:Vmn2r72	UTSW	7	85750539	critical splice donor site	probably null
R6362:Vmn2r72	UTSW	7	85751174	missense	probably damaging	1.00
R6594:Vmn2r72	UTSW	7	85749684	missense	probably benign	0.32
R6794:Vmn2r72	UTSW	7	85737996	missense	probably damaging	1.00
R7113:Vmn2r72	UTSW	7	85749803	splice site	probably null
R7189:Vmn2r72	UTSW	7	85754917	missense	probably benign	0.36
R7266:Vmn2r72	UTSW	7	85738274	nonsense	probably null
R7323:Vmn2r72	UTSW	7	85750563	missense	probably benign
R7426:Vmn2r72	UTSW	7	85751140	missense	probably benign
R7606:Vmn2r72	UTSW	7	85751154	missense	possibly damaging	0.91
R7651:Vmn2r72	UTSW	7	85751938	missense	probably damaging	1.00
R7688:Vmn2r72	UTSW	7	85754890	missense	probably benign	0.32
R7753:Vmn2r72	UTSW	7	85750626	missense	probably damaging	1.00
R7843:Vmn2r72	UTSW	7	85749630	missense	probably benign	0.01
R8157:Vmn2r72	UTSW	7	85751233	missense	probably benign	0.09
R8254:Vmn2r72	UTSW	7	85751019	missense	probably damaging	1.00
R8389:Vmn2r72	UTSW	7	85751960	missense	probably damaging	0.99
R8444:Vmn2r72	UTSW	7	85738175	missense	probably benign
R8989:Vmn2r72	UTSW	7	85754926	missense	probably benign	0.10
R9015:Vmn2r72	UTSW	7	85749180	missense	probably benign	0.01
R9080:Vmn2r72	UTSW	7	85738256	missense	probably damaging	1.00
R9269:Vmn2r72	UTSW	7	85751203	missense	probably benign	0.03
R9317:Vmn2r72	UTSW	7	85754814	missense	probably benign	0.04
Z1176:Vmn2r72	UTSW	7	85749191	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ACACTTTACTTTCCAAAATGGACATTGAGAAC -3'
(R):5'- AGGTCATCTGCCAAGTCGTCAAC -3'

Sequencing Primer
(F):5'- CATTTTCAGGGCAGGGGTTA -3'
(R):5'- atctgcctgcttctgcc -3'

Posted On

2014-01-29