Incidental Mutation 'R1248:Fuom'
ID152191
Institutional Source Beutler Lab
Gene Symbol Fuom
Ensembl Gene ENSMUSG00000025466
Gene Namefucose mutarotase
Synonyms1810014F10Rik
MMRRC Submission 039315-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R1248 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location140096770-140102441 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 140099718 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000026539] [ENSMUST00000026540] [ENSMUST00000120034] [ENSMUST00000121115] [ENSMUST00000142105] [ENSMUST00000148716]
Predicted Effect probably benign
Transcript: ENSMUST00000026539
SMART Domains Protein: ENSMUSP00000026539
Gene: ENSMUSG00000025466

DomainStartEndE-ValueType
Pfam:RbsD_FucU 5 148 1.3e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000026540
SMART Domains Protein: ENSMUSP00000026540
Gene: ENSMUSG00000025467

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:PRAP 100 144 1.1e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120034
SMART Domains Protein: ENSMUSP00000112429
Gene: ENSMUSG00000025466

DomainStartEndE-ValueType
Pfam:RbsD_FucU 5 134 5.9e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121115
SMART Domains Protein: ENSMUSP00000112970
Gene: ENSMUSG00000025466

DomainStartEndE-ValueType
Pfam:RbsD_FucU 5 117 9.1e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125421
Predicted Effect probably benign
Transcript: ENSMUST00000128527
SMART Domains Protein: ENSMUSP00000118717
Gene: ENSMUSG00000025466

DomainStartEndE-ValueType
Pfam:RbsD_FucU 1 105 4.4e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132582
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133834
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138197
Predicted Effect probably benign
Transcript: ENSMUST00000142105
SMART Domains Protein: ENSMUSP00000115799
Gene: ENSMUSG00000025466

DomainStartEndE-ValueType
Pfam:RbsD_FucU 1 134 3e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143197
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147713
Predicted Effect probably benign
Transcript: ENSMUST00000148716
SMART Domains Protein: ENSMUSP00000120353
Gene: ENSMUSG00000025466

DomainStartEndE-ValueType
Pfam:RbsD_FucU 5 133 7.8e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211677
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155777
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.5%
Validation Efficiency 98% (43/44)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted allele exhibit reduced female sexual receptivity and masculinized sexual behaviors in female mice. Heterozygous mice exhibit intermediate phenotypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb A T 10: 10,395,310 F863Y probably damaging Het
Akap12 A G 10: 4,353,847 E219G probably benign Het
Akr1c20 G A 13: 4,514,400 T38I possibly damaging Het
Ap5z1 C A 5: 142,474,500 S511R probably benign Het
Arhgap11a T A 2: 113,834,102 H612L possibly damaging Het
Atp2b2 G T 6: 113,817,192 S118Y probably damaging Het
Boc A T 16: 44,520,473 M38K probably benign Het
Ccdc171 A T 4: 83,681,244 E773D possibly damaging Het
Dmtn C T 14: 70,612,658 probably benign Het
Dnah10 G A 5: 124,755,823 probably benign Het
Efcab1 A G 16: 14,924,137 M212V probably benign Het
Fam83b T C 9: 76,503,076 N184S probably benign Het
Fam98c A G 7: 29,152,840 M98T probably damaging Het
Fbn1 T C 2: 125,301,609 K2867E probably benign Het
Fsip2 A T 2: 82,989,763 E5280V possibly damaging Het
Gm3476 A T 14: 6,118,512 S204T probably benign Het
Grhl3 A G 4: 135,561,306 F23L probably benign Het
Il4i1 G T 7: 44,839,789 R334L probably damaging Het
Ipo13 A G 4: 117,901,031 S712P probably damaging Het
Lama4 G T 10: 39,056,847 S573I probably damaging Het
Lrp11 A G 10: 7,604,294 H371R probably benign Het
Mkln1 T A 6: 31,489,368 I520N probably damaging Het
Nagpa G T 16: 5,198,616 C236* probably null Het
Nktr A G 9: 121,727,370 N38S probably damaging Het
Nlrp10 G A 7: 108,925,881 R131C probably benign Het
Nxpe2 T C 9: 48,319,911 D386G possibly damaging Het
Prpf39 T A 12: 65,053,966 probably benign Het
Retreg2 A G 1: 75,145,111 probably benign Het
S100a4 G T 3: 90,605,777 S60I possibly damaging Het
Slc12a3 G T 8: 94,333,277 G184C probably damaging Het
Slc25a46 C T 18: 31,609,754 D20N possibly damaging Het
Smc3 A G 19: 53,634,078 K695E probably benign Het
Speer2 A T 16: 69,857,067 probably null Het
Taar4 T G 10: 23,961,038 V182G possibly damaging Het
Ttll1 C G 15: 83,502,125 S93T probably benign Het
Ubl3 A T 5: 148,506,198 probably null Het
Vmn2r16 A G 5: 109,360,777 N457S probably benign Het
Vmn2r72 T C 7: 85,749,188 E528G probably benign Het
Zfp52 A C 17: 21,560,049 E53A probably damaging Het
Other mutations in Fuom
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1938:Fuom UTSW 7 140099608 missense probably benign 0.01
R2924:Fuom UTSW 7 140099949 missense probably benign
R2925:Fuom UTSW 7 140099949 missense probably benign
R4722:Fuom UTSW 7 140099567 unclassified probably benign
R5542:Fuom UTSW 7 140100112 makesense probably null
R5958:Fuom UTSW 7 140099898 missense probably damaging 1.00
R7392:Fuom UTSW 7 140101160 missense probably damaging 1.00
R7734:Fuom UTSW 7 140099542 missense unknown
R7892:Fuom UTSW 7 140099579 missense unknown
R8026:Fuom UTSW 7 140100154 missense
Predicted Primers PCR Primer
(F):5'- TCAGCAGAGTCTCTCAAGATCTGCC -3'
(R):5'- AGCCTAGAAGACCAGGGTTCCATTG -3'

Sequencing Primer
(F):5'- AAGATCTGCCATCTTCTTGAGC -3'
(R):5'- TCTCCTGATGAGGGACTCAAATC -3'
Posted On2014-01-29