Incidental Mutation 'R1248:Nxpe2'
ID152193
Institutional Source Beutler Lab
Gene Symbol Nxpe2
Ensembl Gene ENSMUSG00000032028
Gene Nameneurexophilin and PC-esterase domain family, member 2
Synonyms
MMRRC Submission 039315-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R1248 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location48318006-48353454 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 48319911 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 386 (D386G)
Ref Sequence ENSEMBL: ENSMUSP00000034527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034527] [ENSMUST00000135457] [ENSMUST00000215780] [ENSMUST00000216998]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034527
AA Change: D386G

PolyPhen 2 Score 0.463 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000034527
Gene: ENSMUSG00000032028
AA Change: D386G

DomainStartEndE-ValueType
transmembrane domain 22 39 N/A INTRINSIC
Pfam:Neurexophilin 80 277 1.2e-18 PFAM
low complexity region 307 316 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135457
Predicted Effect probably benign
Transcript: ENSMUST00000215780
Predicted Effect probably benign
Transcript: ENSMUST00000216998
Meta Mutation Damage Score 0.3088 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.5%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb A T 10: 10,395,310 F863Y probably damaging Het
Akap12 A G 10: 4,353,847 E219G probably benign Het
Akr1c20 G A 13: 4,514,400 T38I possibly damaging Het
Ap5z1 C A 5: 142,474,500 S511R probably benign Het
Arhgap11a T A 2: 113,834,102 H612L possibly damaging Het
Atp2b2 G T 6: 113,817,192 S118Y probably damaging Het
Boc A T 16: 44,520,473 M38K probably benign Het
Ccdc171 A T 4: 83,681,244 E773D possibly damaging Het
Dmtn C T 14: 70,612,658 probably benign Het
Dnah10 G A 5: 124,755,823 probably benign Het
Efcab1 A G 16: 14,924,137 M212V probably benign Het
Fam83b T C 9: 76,503,076 N184S probably benign Het
Fam98c A G 7: 29,152,840 M98T probably damaging Het
Fbn1 T C 2: 125,301,609 K2867E probably benign Het
Fsip2 A T 2: 82,989,763 E5280V possibly damaging Het
Fuom T C 7: 140,099,718 probably benign Het
Gm3476 A T 14: 6,118,512 S204T probably benign Het
Grhl3 A G 4: 135,561,306 F23L probably benign Het
Il4i1 G T 7: 44,839,789 R334L probably damaging Het
Ipo13 A G 4: 117,901,031 S712P probably damaging Het
Lama4 G T 10: 39,056,847 S573I probably damaging Het
Lrp11 A G 10: 7,604,294 H371R probably benign Het
Mkln1 T A 6: 31,489,368 I520N probably damaging Het
Nagpa G T 16: 5,198,616 C236* probably null Het
Nktr A G 9: 121,727,370 N38S probably damaging Het
Nlrp10 G A 7: 108,925,881 R131C probably benign Het
Prpf39 T A 12: 65,053,966 probably benign Het
Retreg2 A G 1: 75,145,111 probably benign Het
S100a4 G T 3: 90,605,777 S60I possibly damaging Het
Slc12a3 G T 8: 94,333,277 G184C probably damaging Het
Slc25a46 C T 18: 31,609,754 D20N possibly damaging Het
Smc3 A G 19: 53,634,078 K695E probably benign Het
Speer2 A T 16: 69,857,067 probably null Het
Taar4 T G 10: 23,961,038 V182G possibly damaging Het
Ttll1 C G 15: 83,502,125 S93T probably benign Het
Ubl3 A T 5: 148,506,198 probably null Het
Vmn2r16 A G 5: 109,360,777 N457S probably benign Het
Vmn2r72 T C 7: 85,749,188 E528G probably benign Het
Zfp52 A C 17: 21,560,049 E53A probably damaging Het
Other mutations in Nxpe2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01414:Nxpe2 APN 9 48320623 missense probably benign 0.00
IGL01830:Nxpe2 APN 9 48326494 missense probably damaging 1.00
IGL02039:Nxpe2 APN 9 48319659 missense probably benign 0.11
IGL02618:Nxpe2 APN 9 48326334 missense probably damaging 1.00
IGL03065:Nxpe2 APN 9 48319692 missense possibly damaging 0.68
IGL03128:Nxpe2 APN 9 48319498 missense probably benign 0.12
P4717OSA:Nxpe2 UTSW 9 48326377 missense probably benign 0.08
R0019:Nxpe2 UTSW 9 48319780 missense probably benign 0.37
R0172:Nxpe2 UTSW 9 48319909 missense possibly damaging 0.76
R0255:Nxpe2 UTSW 9 48340570 critical splice donor site probably null
R0415:Nxpe2 UTSW 9 48326614 missense probably damaging 0.99
R1061:Nxpe2 UTSW 9 48326363 missense probably damaging 1.00
R1311:Nxpe2 UTSW 9 48326614 missense probably damaging 0.99
R1393:Nxpe2 UTSW 9 48326614 missense probably damaging 0.99
R1827:Nxpe2 UTSW 9 48326614 missense probably damaging 0.99
R1828:Nxpe2 UTSW 9 48326614 missense probably damaging 0.99
R1831:Nxpe2 UTSW 9 48326152 missense probably benign 0.01
R1866:Nxpe2 UTSW 9 48326821 missense probably benign 0.01
R1889:Nxpe2 UTSW 9 48326614 missense probably damaging 0.99
R1892:Nxpe2 UTSW 9 48326614 missense probably damaging 0.99
R1903:Nxpe2 UTSW 9 48319606 missense probably benign 0.40
R1928:Nxpe2 UTSW 9 48326614 missense probably damaging 0.99
R1959:Nxpe2 UTSW 9 48319726 missense probably benign 0.06
R4594:Nxpe2 UTSW 9 48319482 missense probably damaging 1.00
R4697:Nxpe2 UTSW 9 48320521 missense probably benign 0.03
R4909:Nxpe2 UTSW 9 48319597 missense possibly damaging 0.93
R5048:Nxpe2 UTSW 9 48326088 splice site probably null
R5372:Nxpe2 UTSW 9 48339519 missense possibly damaging 0.66
R5614:Nxpe2 UTSW 9 48323101 missense probably benign 0.30
R5762:Nxpe2 UTSW 9 48319575 missense probably benign 0.02
R6151:Nxpe2 UTSW 9 48326191 missense probably benign 0.01
R6958:Nxpe2 UTSW 9 48326266 missense probably damaging 1.00
R7130:Nxpe2 UTSW 9 48339537 missense probably benign 0.00
R7138:Nxpe2 UTSW 9 48320706 missense probably damaging 1.00
R7250:Nxpe2 UTSW 9 48326796 missense possibly damaging 0.77
R7289:Nxpe2 UTSW 9 48323039 critical splice donor site probably null
R7949:Nxpe2 UTSW 9 48323097 missense possibly damaging 0.83
R7973:Nxpe2 UTSW 9 48319868 missense probably damaging 0.99
R8327:Nxpe2 UTSW 9 48319759 missense probably benign 0.01
R8725:Nxpe2 UTSW 9 48326773 missense probably benign 0.01
R8727:Nxpe2 UTSW 9 48326773 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGACAATTGCTGTACCACTGTCTCC -3'
(R):5'- GGCGTTTAATCAAAGGCACTAGCAC -3'

Sequencing Primer
(F):5'- GTACCACTGTCTCCTGCCAC -3'
(R):5'- TCAAAGGCACTAGCACTATCTTTC -3'
Posted On2014-01-29