Incidental Mutation 'R1248:Akap12'
ID152196
Institutional Source Beutler Lab
Gene Symbol Akap12
Ensembl Gene ENSMUSG00000038587
Gene NameA kinase (PRKA) anchor protein (gravin) 12
SynonymsSSeCKS, Tsga12, Srcs5
MMRRC Submission 039315-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R1248 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location4266380-4359470 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4353847 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 219 (E219G)
Ref Sequence ENSEMBL: ENSMUSP00000150261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045730] [ENSMUST00000215696]
Predicted Effect probably benign
Transcript: ENSMUST00000045730
AA Change: E324G

PolyPhen 2 Score 0.114 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000035829
Gene: ENSMUSG00000038587
AA Change: E324G

DomainStartEndE-ValueType
low complexity region 30 48 N/A INTRINSIC
low complexity region 120 132 N/A INTRINSIC
low complexity region 151 171 N/A INTRINSIC
low complexity region 187 198 N/A INTRINSIC
internal_repeat_1 212 279 3.2e-5 PROSPERO
coiled coil region 304 331 N/A INTRINSIC
low complexity region 387 398 N/A INTRINSIC
low complexity region 407 424 N/A INTRINSIC
low complexity region 432 446 N/A INTRINSIC
low complexity region 497 526 N/A INTRINSIC
low complexity region 550 561 N/A INTRINSIC
low complexity region 571 582 N/A INTRINSIC
Pfam:WSK 591 619 2e-15 PFAM
low complexity region 626 637 N/A INTRINSIC
low complexity region 673 684 N/A INTRINSIC
low complexity region 700 711 N/A INTRINSIC
Pfam:WSK 738 766 2.3e-15 PFAM
Pfam:WSK 779 807 6.2e-11 PFAM
low complexity region 951 973 N/A INTRINSIC
low complexity region 1050 1065 N/A INTRINSIC
low complexity region 1177 1187 N/A INTRINSIC
internal_repeat_1 1197 1265 3.2e-5 PROSPERO
low complexity region 1303 1312 N/A INTRINSIC
Pfam:RII_binding_1 1501 1518 4.2e-7 PFAM
coiled coil region 1651 1676 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000215696
AA Change: E219G

PolyPhen 2 Score 0.114 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216139
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.5%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein is expressed in endothelial cells, cultured fibroblasts, and osteosarcoma cells. It associates with protein kinases A and C and phosphatase, and serves as a scaffold protein in signal transduction. This protein and RII PKA colocalize at the cell periphery. This protein is a cell growth-related protein. Antibodies to this protein can be produced by patients with myasthenia gravis. Alternative splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knockout allele disrupting all three common isoforms suffer from prostatic hyperplasia and focal dysplasia, and from delayed fertility. Mice homozygous for a gene trap allele exhibit enhanced cardiac function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb A T 10: 10,395,310 F863Y probably damaging Het
Akr1c20 G A 13: 4,514,400 T38I possibly damaging Het
Ap5z1 C A 5: 142,474,500 S511R probably benign Het
Arhgap11a T A 2: 113,834,102 H612L possibly damaging Het
Atp2b2 G T 6: 113,817,192 S118Y probably damaging Het
Boc A T 16: 44,520,473 M38K probably benign Het
Ccdc171 A T 4: 83,681,244 E773D possibly damaging Het
Dmtn C T 14: 70,612,658 probably benign Het
Dnah10 G A 5: 124,755,823 probably benign Het
Efcab1 A G 16: 14,924,137 M212V probably benign Het
Fam83b T C 9: 76,503,076 N184S probably benign Het
Fam98c A G 7: 29,152,840 M98T probably damaging Het
Fbn1 T C 2: 125,301,609 K2867E probably benign Het
Fsip2 A T 2: 82,989,763 E5280V possibly damaging Het
Fuom T C 7: 140,099,718 probably benign Het
Gm3476 A T 14: 6,118,512 S204T probably benign Het
Grhl3 A G 4: 135,561,306 F23L probably benign Het
Il4i1 G T 7: 44,839,789 R334L probably damaging Het
Ipo13 A G 4: 117,901,031 S712P probably damaging Het
Lama4 G T 10: 39,056,847 S573I probably damaging Het
Lrp11 A G 10: 7,604,294 H371R probably benign Het
Mkln1 T A 6: 31,489,368 I520N probably damaging Het
Nagpa G T 16: 5,198,616 C236* probably null Het
Nktr A G 9: 121,727,370 N38S probably damaging Het
Nlrp10 G A 7: 108,925,881 R131C probably benign Het
Nxpe2 T C 9: 48,319,911 D386G possibly damaging Het
Prpf39 T A 12: 65,053,966 probably benign Het
Retreg2 A G 1: 75,145,111 probably benign Het
S100a4 G T 3: 90,605,777 S60I possibly damaging Het
Slc12a3 G T 8: 94,333,277 G184C probably damaging Het
Slc25a46 C T 18: 31,609,754 D20N possibly damaging Het
Smc3 A G 19: 53,634,078 K695E probably benign Het
Speer2 A T 16: 69,857,067 probably null Het
Taar4 T G 10: 23,961,038 V182G possibly damaging Het
Ttll1 C G 15: 83,502,125 S93T probably benign Het
Ubl3 A T 5: 148,506,198 probably null Het
Vmn2r16 A G 5: 109,360,777 N457S probably benign Het
Vmn2r72 T C 7: 85,749,188 E528G probably benign Het
Zfp52 A C 17: 21,560,049 E53A probably damaging Het
Other mutations in Akap12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00712:Akap12 APN 10 4357164 missense probably benign 0.09
IGL01306:Akap12 APN 10 4353273 missense probably benign 0.04
IGL01360:Akap12 APN 10 4357537 missense probably benign 0.02
IGL01455:Akap12 APN 10 4356886 missense probably damaging 0.99
IGL01458:Akap12 APN 10 4354060 missense probably damaging 1.00
IGL01465:Akap12 APN 10 4356886 missense probably damaging 0.99
IGL02348:Akap12 APN 10 4354722 missense probably damaging 1.00
IGL02425:Akap12 APN 10 4356034 missense possibly damaging 0.67
IGL02502:Akap12 APN 10 4353163 missense probably damaging 1.00
IGL02736:Akap12 APN 10 4355637 missense probably benign
IGL02969:Akap12 APN 10 4354864 missense probably damaging 1.00
IGL03345:Akap12 APN 10 4356697 missense probably benign 0.42
ANU23:Akap12 UTSW 10 4353273 missense probably benign 0.04
FR4976:Akap12 UTSW 10 4353837 small insertion probably benign
R0004:Akap12 UTSW 10 4353218 missense possibly damaging 0.56
R0004:Akap12 UTSW 10 4353220 missense probably damaging 1.00
R0207:Akap12 UTSW 10 4353333 missense probably damaging 1.00
R0580:Akap12 UTSW 10 4354741 missense possibly damaging 0.91
R0675:Akap12 UTSW 10 4353315 missense probably benign 0.06
R1338:Akap12 UTSW 10 4313773 missense possibly damaging 0.95
R1448:Akap12 UTSW 10 4355475 missense probably benign 0.22
R1458:Akap12 UTSW 10 4353693 missense probably damaging 1.00
R1521:Akap12 UTSW 10 4354804 missense probably benign 0.02
R1585:Akap12 UTSW 10 4353640 missense probably benign 0.11
R1725:Akap12 UTSW 10 4353942 missense probably damaging 1.00
R1756:Akap12 UTSW 10 4357574 missense probably benign 0.04
R1914:Akap12 UTSW 10 4356685 missense probably benign 0.01
R1978:Akap12 UTSW 10 4313855 missense probably benign 0.06
R2032:Akap12 UTSW 10 4356673 missense possibly damaging 0.50
R2041:Akap12 UTSW 10 4356489 missense probably benign 0.01
R3009:Akap12 UTSW 10 4357891 missense probably benign 0.06
R3872:Akap12 UTSW 10 4357590 missense probably benign 0.00
R3874:Akap12 UTSW 10 4357590 missense probably benign 0.00
R3875:Akap12 UTSW 10 4357590 missense probably benign 0.00
R3944:Akap12 UTSW 10 4357347 missense probably benign 0.00
R4612:Akap12 UTSW 10 4354456 missense probably damaging 1.00
R4889:Akap12 UTSW 10 4356535 missense probably damaging 0.97
R5043:Akap12 UTSW 10 4355047 missense probably damaging 1.00
R5176:Akap12 UTSW 10 4353947 missense probably benign 0.19
R5278:Akap12 UTSW 10 4354792 missense probably benign 0.02
R5320:Akap12 UTSW 10 4357291 missense probably benign 0.00
R5443:Akap12 UTSW 10 4355576 missense probably damaging 1.00
R5533:Akap12 UTSW 10 4357405 missense probably damaging 1.00
R6133:Akap12 UTSW 10 4355178 missense probably benign 0.05
R6142:Akap12 UTSW 10 4313740 splice site probably null
R6190:Akap12 UTSW 10 4356268 missense possibly damaging 0.92
R6458:Akap12 UTSW 10 4355148 missense probably damaging 1.00
R6562:Akap12 UTSW 10 4356141 nonsense probably null
R6701:Akap12 UTSW 10 4355243 missense probably damaging 1.00
R6828:Akap12 UTSW 10 4354606 missense probably damaging 0.96
R6991:Akap12 UTSW 10 4357122 nonsense probably null
R7023:Akap12 UTSW 10 4356895 missense probably benign 0.05
R7102:Akap12 UTSW 10 4353226 missense probably damaging 1.00
R7483:Akap12 UTSW 10 4353967 missense probably benign 0.00
R7538:Akap12 UTSW 10 4353213 missense probably damaging 1.00
R7664:Akap12 UTSW 10 4353748 missense probably damaging 1.00
R7704:Akap12 UTSW 10 4356082 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTCCAGCTACTCACTGTCAAGAAG -3'
(R):5'- TTCCGTTGCCAAAGGAGCACAC -3'

Sequencing Primer
(F):5'- TTCAAGCCGAATCTGGTCAAG -3'
(R):5'- GGAGCACACTTCTCCGAC -3'
Posted On2014-01-29