Incidental Mutation 'R1248:Lrp11'
ID152197
Institutional Source Beutler Lab
Gene Symbol Lrp11
Ensembl Gene ENSMUSG00000019796
Gene Namelow density lipoprotein receptor-related protein 11
Synonyms
MMRRC Submission 039315-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R1248 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location7589800-7625483 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 7604294 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 371 (H371R)
Ref Sequence ENSEMBL: ENSMUSP00000121704 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019931] [ENSMUST00000124961] [ENSMUST00000130590] [ENSMUST00000134346] [ENSMUST00000135907]
Predicted Effect probably benign
Transcript: ENSMUST00000019931
AA Change: H371R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000019931
Gene: ENSMUSG00000019796
AA Change: H371R

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
MANEC 69 172 1.24e-42 SMART
PKD 198 283 7.62e-2 SMART
LDLa 293 330 9.45e-6 SMART
transmembrane domain 434 456 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124961
AA Change: H115R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000114479
Gene: ENSMUSG00000019796
AA Change: H115R

DomainStartEndE-ValueType
Blast:PKD 1 69 2e-42 BLAST
transmembrane domain 178 200 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130590
AA Change: H371R

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000121704
Gene: ENSMUSG00000019796
AA Change: H371R

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
MANEC 69 172 1.24e-42 SMART
PKD 198 283 7.62e-2 SMART
LDLa 293 330 9.45e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131528
Predicted Effect probably benign
Transcript: ENSMUST00000134346
AA Change: H376R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000122853
Gene: ENSMUSG00000019796
AA Change: H376R

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
MANEC 69 172 1.24e-42 SMART
PKD 198 288 1.59e-1 SMART
LDLa 298 335 9.45e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135907
SMART Domains Protein: ENSMUSP00000122359
Gene: ENSMUSG00000019796

DomainStartEndE-ValueType
MANEC 44 147 1.24e-42 SMART
transmembrane domain 196 218 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.5%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb A T 10: 10,395,310 F863Y probably damaging Het
Akap12 A G 10: 4,353,847 E219G probably benign Het
Akr1c20 G A 13: 4,514,400 T38I possibly damaging Het
Ap5z1 C A 5: 142,474,500 S511R probably benign Het
Arhgap11a T A 2: 113,834,102 H612L possibly damaging Het
Atp2b2 G T 6: 113,817,192 S118Y probably damaging Het
Boc A T 16: 44,520,473 M38K probably benign Het
Ccdc171 A T 4: 83,681,244 E773D possibly damaging Het
Dmtn C T 14: 70,612,658 probably benign Het
Dnah10 G A 5: 124,755,823 probably benign Het
Efcab1 A G 16: 14,924,137 M212V probably benign Het
Fam83b T C 9: 76,503,076 N184S probably benign Het
Fam98c A G 7: 29,152,840 M98T probably damaging Het
Fbn1 T C 2: 125,301,609 K2867E probably benign Het
Fsip2 A T 2: 82,989,763 E5280V possibly damaging Het
Fuom T C 7: 140,099,718 probably benign Het
Gm3476 A T 14: 6,118,512 S204T probably benign Het
Grhl3 A G 4: 135,561,306 F23L probably benign Het
Il4i1 G T 7: 44,839,789 R334L probably damaging Het
Ipo13 A G 4: 117,901,031 S712P probably damaging Het
Lama4 G T 10: 39,056,847 S573I probably damaging Het
Mkln1 T A 6: 31,489,368 I520N probably damaging Het
Nagpa G T 16: 5,198,616 C236* probably null Het
Nktr A G 9: 121,727,370 N38S probably damaging Het
Nlrp10 G A 7: 108,925,881 R131C probably benign Het
Nxpe2 T C 9: 48,319,911 D386G possibly damaging Het
Prpf39 T A 12: 65,053,966 probably benign Het
Retreg2 A G 1: 75,145,111 probably benign Het
S100a4 G T 3: 90,605,777 S60I possibly damaging Het
Slc12a3 G T 8: 94,333,277 G184C probably damaging Het
Slc25a46 C T 18: 31,609,754 D20N possibly damaging Het
Smc3 A G 19: 53,634,078 K695E probably benign Het
Speer2 A T 16: 69,857,067 probably null Het
Taar4 T G 10: 23,961,038 V182G possibly damaging Het
Ttll1 C G 15: 83,502,125 S93T probably benign Het
Ubl3 A T 5: 148,506,198 probably null Het
Vmn2r16 A G 5: 109,360,777 N457S probably benign Het
Vmn2r72 T C 7: 85,749,188 E528G probably benign Het
Zfp52 A C 17: 21,560,049 E53A probably damaging Het
Other mutations in Lrp11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03123:Lrp11 APN 10 7602925 missense probably damaging 1.00
R0962:Lrp11 UTSW 10 7590296 missense probably benign 0.01
R1822:Lrp11 UTSW 10 7596197 missense probably damaging 1.00
R1895:Lrp11 UTSW 10 7623776 missense probably damaging 1.00
R1902:Lrp11 UTSW 10 7623780 missense probably damaging 1.00
R1903:Lrp11 UTSW 10 7623780 missense probably damaging 1.00
R1946:Lrp11 UTSW 10 7623776 missense probably damaging 1.00
R4727:Lrp11 UTSW 10 7590584 missense probably benign 0.01
R4784:Lrp11 UTSW 10 7604201 missense possibly damaging 0.95
R6192:Lrp11 UTSW 10 7598690 critical splice acceptor site probably null
R6916:Lrp11 UTSW 10 7608714 splice site probably null
R7622:Lrp11 UTSW 10 7590172 missense unknown
R7697:Lrp11 UTSW 10 7604219 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GCTGAGATGATAGTTCTTCAGCATCCG -3'
(R):5'- GGGCTCTTCCACTTATATACAGCTCCA -3'

Sequencing Primer
(F):5'- gagagagagagagagagagagag -3'
(R):5'- ttttgttttgttttgctttgtttGG -3'
Posted On2014-01-29