Incidental Mutation 'R1248:Taar4'
ID152199
Institutional Source Beutler Lab
Gene Symbol Taar4
Ensembl Gene ENSMUSG00000069707
Gene Nametrace amine-associated receptor 4
Synonyms
MMRRC Submission 039315-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R1248 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location23960494-23961537 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 23961038 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 182 (V182G)
Ref Sequence ENSEMBL: ENSMUSP00000090330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092660]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092660
AA Change: V182G

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000090330
Gene: ENSMUSG00000069707
AA Change: V182G

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 44 328 9.2e-11 PFAM
Pfam:7tm_1 50 313 4.6e-63 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.5%
Validation Efficiency 98% (43/44)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired olfactory response and aversion to PEA and puma urine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb A T 10: 10,395,310 F863Y probably damaging Het
Akap12 A G 10: 4,353,847 E219G probably benign Het
Akr1c20 G A 13: 4,514,400 T38I possibly damaging Het
Ap5z1 C A 5: 142,474,500 S511R probably benign Het
Arhgap11a T A 2: 113,834,102 H612L possibly damaging Het
Atp2b2 G T 6: 113,817,192 S118Y probably damaging Het
Boc A T 16: 44,520,473 M38K probably benign Het
Ccdc171 A T 4: 83,681,244 E773D possibly damaging Het
Dmtn C T 14: 70,612,658 probably benign Het
Dnah10 G A 5: 124,755,823 probably benign Het
Efcab1 A G 16: 14,924,137 M212V probably benign Het
Fam83b T C 9: 76,503,076 N184S probably benign Het
Fam98c A G 7: 29,152,840 M98T probably damaging Het
Fbn1 T C 2: 125,301,609 K2867E probably benign Het
Fsip2 A T 2: 82,989,763 E5280V possibly damaging Het
Fuom T C 7: 140,099,718 probably benign Het
Gm3476 A T 14: 6,118,512 S204T probably benign Het
Grhl3 A G 4: 135,561,306 F23L probably benign Het
Il4i1 G T 7: 44,839,789 R334L probably damaging Het
Ipo13 A G 4: 117,901,031 S712P probably damaging Het
Lama4 G T 10: 39,056,847 S573I probably damaging Het
Lrp11 A G 10: 7,604,294 H371R probably benign Het
Mkln1 T A 6: 31,489,368 I520N probably damaging Het
Nagpa G T 16: 5,198,616 C236* probably null Het
Nktr A G 9: 121,727,370 N38S probably damaging Het
Nlrp10 G A 7: 108,925,881 R131C probably benign Het
Nxpe2 T C 9: 48,319,911 D386G possibly damaging Het
Prpf39 T A 12: 65,053,966 probably benign Het
Retreg2 A G 1: 75,145,111 probably benign Het
S100a4 G T 3: 90,605,777 S60I possibly damaging Het
Slc12a3 G T 8: 94,333,277 G184C probably damaging Het
Slc25a46 C T 18: 31,609,754 D20N possibly damaging Het
Smc3 A G 19: 53,634,078 K695E probably benign Het
Speer2 A T 16: 69,857,067 probably null Het
Ttll1 C G 15: 83,502,125 S93T probably benign Het
Ubl3 A T 5: 148,506,198 probably null Het
Vmn2r16 A G 5: 109,360,777 N457S probably benign Het
Vmn2r72 T C 7: 85,749,188 E528G probably benign Het
Zfp52 A C 17: 21,560,049 E53A probably damaging Het
Other mutations in Taar4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02576:Taar4 APN 10 23961011 missense probably damaging 1.00
IGL03202:Taar4 APN 10 23960794 missense probably damaging 1.00
I2288:Taar4 UTSW 10 23960920 missense probably benign 0.03
R0103:Taar4 UTSW 10 23961406 missense probably damaging 1.00
R0103:Taar4 UTSW 10 23961406 missense probably damaging 1.00
R0514:Taar4 UTSW 10 23960882 missense probably damaging 1.00
R1222:Taar4 UTSW 10 23961332 missense probably benign 0.05
R1514:Taar4 UTSW 10 23960612 missense possibly damaging 0.71
R1921:Taar4 UTSW 10 23961341 missense probably damaging 1.00
R2074:Taar4 UTSW 10 23961173 missense probably benign 0.18
R2354:Taar4 UTSW 10 23961014 missense probably damaging 1.00
R2392:Taar4 UTSW 10 23961274 missense possibly damaging 0.94
R2698:Taar4 UTSW 10 23961430 missense probably damaging 1.00
R3902:Taar4 UTSW 10 23961015 missense probably damaging 1.00
R4688:Taar4 UTSW 10 23960833 missense probably damaging 1.00
R5495:Taar4 UTSW 10 23961283 missense possibly damaging 0.95
R5595:Taar4 UTSW 10 23960741 missense probably damaging 1.00
R5773:Taar4 UTSW 10 23961158 missense probably damaging 1.00
R7403:Taar4 UTSW 10 23961059 missense probably damaging 1.00
R7581:Taar4 UTSW 10 23961154 missense probably damaging 0.97
R7736:Taar4 UTSW 10 23960999 missense probably damaging 1.00
R7859:Taar4 UTSW 10 23961134 missense probably benign 0.35
R8676:Taar4 UTSW 10 23960903 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- ATTGCCCACTTCAAGCAGCTCC -3'
(R):5'- TGTACCAATCTGCCTGGCATGTTTC -3'

Sequencing Primer
(F):5'- AGTATGATCCGGTCCATCGAG -3'
(R):5'- TTCTGGGCAACTGTGAAAATG -3'
Posted On2014-01-29