Incidental Mutation 'R1248:Akr1c20'
ID152202
Institutional Source Beutler Lab
Gene Symbol Akr1c20
Ensembl Gene ENSMUSG00000054757
Gene Namealdo-keto reductase family 1, member C20
Synonyms2610528B18Rik
MMRRC Submission 039315-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1248 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location4486849-4523345 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 4514400 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 38 (T38I)
Ref Sequence ENSEMBL: ENSMUSP00000079232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078239] [ENSMUST00000080361]
Predicted Effect probably benign
Transcript: ENSMUST00000078239
AA Change: T38I

PolyPhen 2 Score 0.386 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000077363
Gene: ENSMUSG00000054757
AA Change: T38I

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 18 98 4.7e-12 PFAM
Pfam:Aldo_ket_red 87 260 6e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000080361
AA Change: T38I

PolyPhen 2 Score 0.525 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000079232
Gene: ENSMUSG00000054757
AA Change: T38I

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 18 301 2.8e-55 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000221564
AA Change: T37I
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.5%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb A T 10: 10,395,310 F863Y probably damaging Het
Akap12 A G 10: 4,353,847 E219G probably benign Het
Ap5z1 C A 5: 142,474,500 S511R probably benign Het
Arhgap11a T A 2: 113,834,102 H612L possibly damaging Het
Atp2b2 G T 6: 113,817,192 S118Y probably damaging Het
Boc A T 16: 44,520,473 M38K probably benign Het
Ccdc171 A T 4: 83,681,244 E773D possibly damaging Het
Dmtn C T 14: 70,612,658 probably benign Het
Dnah10 G A 5: 124,755,823 probably benign Het
Efcab1 A G 16: 14,924,137 M212V probably benign Het
Fam83b T C 9: 76,503,076 N184S probably benign Het
Fam98c A G 7: 29,152,840 M98T probably damaging Het
Fbn1 T C 2: 125,301,609 K2867E probably benign Het
Fsip2 A T 2: 82,989,763 E5280V possibly damaging Het
Fuom T C 7: 140,099,718 probably benign Het
Gm3476 A T 14: 6,118,512 S204T probably benign Het
Grhl3 A G 4: 135,561,306 F23L probably benign Het
Il4i1 G T 7: 44,839,789 R334L probably damaging Het
Ipo13 A G 4: 117,901,031 S712P probably damaging Het
Lama4 G T 10: 39,056,847 S573I probably damaging Het
Lrp11 A G 10: 7,604,294 H371R probably benign Het
Mkln1 T A 6: 31,489,368 I520N probably damaging Het
Nagpa G T 16: 5,198,616 C236* probably null Het
Nktr A G 9: 121,727,370 N38S probably damaging Het
Nlrp10 G A 7: 108,925,881 R131C probably benign Het
Nxpe2 T C 9: 48,319,911 D386G possibly damaging Het
Prpf39 T A 12: 65,053,966 probably benign Het
Retreg2 A G 1: 75,145,111 probably benign Het
S100a4 G T 3: 90,605,777 S60I possibly damaging Het
Slc12a3 G T 8: 94,333,277 G184C probably damaging Het
Slc25a46 C T 18: 31,609,754 D20N possibly damaging Het
Smc3 A G 19: 53,634,078 K695E probably benign Het
Speer2 A T 16: 69,857,067 probably null Het
Taar4 T G 10: 23,961,038 V182G possibly damaging Het
Ttll1 C G 15: 83,502,125 S93T probably benign Het
Ubl3 A T 5: 148,506,198 probably null Het
Vmn2r16 A G 5: 109,360,777 N457S probably benign Het
Vmn2r72 T C 7: 85,749,188 E528G probably benign Het
Zfp52 A C 17: 21,560,049 E53A probably damaging Het
Other mutations in Akr1c20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Akr1c20 APN 13 4512665 critical splice donor site probably null
IGL01799:Akr1c20 APN 13 4514258 splice site probably null
IGL01930:Akr1c20 APN 13 4507648 intron probably benign
IGL02277:Akr1c20 APN 13 4514405 missense probably benign 0.01
IGL02811:Akr1c20 APN 13 4512683 missense possibly damaging 0.86
IGL03349:Akr1c20 APN 13 4508250 nonsense probably null
R0165:Akr1c20 UTSW 13 4523296 missense probably benign 0.02
R0193:Akr1c20 UTSW 13 4511293 splice site probably benign
R0440:Akr1c20 UTSW 13 4487208 missense probably benign 0.01
R1396:Akr1c20 UTSW 13 4507727 missense probably damaging 1.00
R1735:Akr1c20 UTSW 13 4487208 missense probably benign 0.00
R2325:Akr1c20 UTSW 13 4523296 missense probably benign 0.02
R2359:Akr1c20 UTSW 13 4523277 missense probably damaging 0.96
R2878:Akr1c20 UTSW 13 4507775 missense probably damaging 1.00
R3712:Akr1c20 UTSW 13 4510223 missense probably damaging 1.00
R4512:Akr1c20 UTSW 13 4507844 missense probably damaging 1.00
R4514:Akr1c20 UTSW 13 4507844 missense probably damaging 1.00
R4544:Akr1c20 UTSW 13 4507844 missense probably damaging 1.00
R4545:Akr1c20 UTSW 13 4507844 missense probably damaging 1.00
R4781:Akr1c20 UTSW 13 4508175 nonsense probably null
R5301:Akr1c20 UTSW 13 4523280 missense probably damaging 1.00
R5826:Akr1c20 UTSW 13 4510223 missense probably damaging 1.00
R7122:Akr1c20 UTSW 13 4511276 missense probably benign 0.01
R7661:Akr1c20 UTSW 13 4508219 missense probably benign 0.00
R7832:Akr1c20 UTSW 13 4512672 missense probably damaging 1.00
R7915:Akr1c20 UTSW 13 4512672 missense probably damaging 1.00
Z1177:Akr1c20 UTSW 13 4523244 missense probably benign
Predicted Primers PCR Primer
(F):5'- TATGTTTAGTTCCCCAAACTTCACCGAC -3'
(R):5'- AGGGAAAGATCCAGACAAACTTGATTGC -3'

Sequencing Primer
(F):5'- TCCCCAAACTTCACCGACTTAATC -3'
(R):5'- GCATTCTTCACTGCAAATGAAC -3'
Posted On2014-01-29