Incidental Mutation 'R1248:Nagpa'
ID152205
Institutional Source Beutler Lab
Gene Symbol Nagpa
Ensembl Gene ENSMUSG00000023143
Gene NameN-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase
Synonymsalpha-GlcNAcase, UCE
MMRRC Submission 039315-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R1248 (G1)
Quality Score196
Status Validated
Chromosome16
Chromosomal Location5195289-5204012 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 5198616 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 236 (C236*)
Ref Sequence ENSEMBL: ENSMUSP00000117051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023911] [ENSMUST00000147567]
Predicted Effect probably null
Transcript: ENSMUST00000023911
AA Change: C379*
SMART Domains Protein: ENSMUSP00000023911
Gene: ENSMUSG00000023143
AA Change: C379*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 32 47 N/A INTRINSIC
Pfam:DUF2233 131 326 5.1e-42 PFAM
EGF_like 329 359 7.09e1 SMART
EGF 362 391 1.36e1 SMART
transmembrane domain 451 473 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144490
Predicted Effect probably null
Transcript: ENSMUST00000147567
AA Change: C236*
SMART Domains Protein: ENSMUSP00000117051
Gene: ENSMUSG00000023143
AA Change: C236*

DomainStartEndE-ValueType
Pfam:DUF2233 1 183 2.1e-35 PFAM
EGF_like 186 216 7.09e1 SMART
EGF 219 248 1.36e1 SMART
transmembrane domain 308 330 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156450
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.5%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hydrolases are transported to lysosomes after binding to mannose 6-phosphate receptors in the trans-Golgi network. This gene encodes the enzyme that catalyzes the second step in the formation of the mannose 6-phosphate recognition marker on lysosomal hydrolases. Commonly known as 'uncovering enzyme' or UCE, this enzyme removes N-acetyl-D-glucosamine (GlcNAc) residues from GlcNAc-alpha-P-mannose moieties and thereby produces the recognition marker. The encoded preproprotein is proteolytically processed by furin to generate the mature enzyme, a homotetramer of two disulfide-linked homodimers. Mutations in this gene are associated with developmental stuttering in human patients. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a null allele have an increased level of acid hydrolases, however the hydrolases contain GlcNAc-P-Man diesters, exhibit a decreased affinity for the cation-independent mannose 6-phosphate receptor and fail to bind to the cation-dependent mannose 6-phosphate receptor. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb A T 10: 10,395,310 F863Y probably damaging Het
Akap12 A G 10: 4,353,847 E219G probably benign Het
Akr1c20 G A 13: 4,514,400 T38I possibly damaging Het
Ap5z1 C A 5: 142,474,500 S511R probably benign Het
Arhgap11a T A 2: 113,834,102 H612L possibly damaging Het
Atp2b2 G T 6: 113,817,192 S118Y probably damaging Het
Boc A T 16: 44,520,473 M38K probably benign Het
Ccdc171 A T 4: 83,681,244 E773D possibly damaging Het
Dmtn C T 14: 70,612,658 probably benign Het
Dnah10 G A 5: 124,755,823 probably benign Het
Efcab1 A G 16: 14,924,137 M212V probably benign Het
Fam83b T C 9: 76,503,076 N184S probably benign Het
Fam98c A G 7: 29,152,840 M98T probably damaging Het
Fbn1 T C 2: 125,301,609 K2867E probably benign Het
Fsip2 A T 2: 82,989,763 E5280V possibly damaging Het
Fuom T C 7: 140,099,718 probably benign Het
Gm3476 A T 14: 6,118,512 S204T probably benign Het
Grhl3 A G 4: 135,561,306 F23L probably benign Het
Il4i1 G T 7: 44,839,789 R334L probably damaging Het
Ipo13 A G 4: 117,901,031 S712P probably damaging Het
Lama4 G T 10: 39,056,847 S573I probably damaging Het
Lrp11 A G 10: 7,604,294 H371R probably benign Het
Mkln1 T A 6: 31,489,368 I520N probably damaging Het
Nktr A G 9: 121,727,370 N38S probably damaging Het
Nlrp10 G A 7: 108,925,881 R131C probably benign Het
Nxpe2 T C 9: 48,319,911 D386G possibly damaging Het
Prpf39 T A 12: 65,053,966 probably benign Het
Retreg2 A G 1: 75,145,111 probably benign Het
S100a4 G T 3: 90,605,777 S60I possibly damaging Het
Slc12a3 G T 8: 94,333,277 G184C probably damaging Het
Slc25a46 C T 18: 31,609,754 D20N possibly damaging Het
Smc3 A G 19: 53,634,078 K695E probably benign Het
Speer2 A T 16: 69,857,067 probably null Het
Taar4 T G 10: 23,961,038 V182G possibly damaging Het
Ttll1 C G 15: 83,502,125 S93T probably benign Het
Ubl3 A T 5: 148,506,198 probably null Het
Vmn2r16 A G 5: 109,360,777 N457S probably benign Het
Vmn2r72 T C 7: 85,749,188 E528G probably benign Het
Zfp52 A C 17: 21,560,049 E53A probably damaging Het
Other mutations in Nagpa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01969:Nagpa APN 16 5195889 missense probably benign 0.02
IGL02719:Nagpa APN 16 5201493 missense possibly damaging 0.78
R1465:Nagpa UTSW 16 5201528 splice site probably benign
R1746:Nagpa UTSW 16 5203639 missense probably damaging 0.96
R2919:Nagpa UTSW 16 5203787 start gained probably benign
R4382:Nagpa UTSW 16 5203955 missense possibly damaging 0.53
R5011:Nagpa UTSW 16 5195879 missense probably benign
R5013:Nagpa UTSW 16 5195879 missense probably benign
R5207:Nagpa UTSW 16 5199614 critical splice donor site probably null
R5225:Nagpa UTSW 16 5203732 missense probably benign 0.00
R5327:Nagpa UTSW 16 5200013 missense possibly damaging 0.90
R6195:Nagpa UTSW 16 5203749 missense probably damaging 0.98
R6539:Nagpa UTSW 16 5203701 missense possibly damaging 0.79
R6874:Nagpa UTSW 16 5196057 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TGAGCTGATGCTGAAACCACCC -3'
(R):5'- TGTGAATGCACCAGCCACTTCTG -3'

Sequencing Primer
(F):5'- GGGACTCTTTCAGTAGGTAGAACATC -3'
(R):5'- CAGCCACTTCTGGCGGG -3'
Posted On2014-01-29