Incidental Mutation 'R1248:Speer2'
ID152208
Institutional Source Beutler Lab
Gene Symbol Speer2
Ensembl Gene ENSMUSG00000063163
Gene Namespermatogenesis associated glutamate (E)-rich protein 2
SynonymsSPEER-2
MMRRC Submission 039315-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R1248 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location69856874-69863744 bp(-) (GRCm38)
Type of Mutationsplice site (67 bp from exon)
DNA Base Change (assembly) A to T at 69857067 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076500] [ENSMUST00000164146] [ENSMUST00000166256]
Predicted Effect probably null
Transcript: ENSMUST00000076500
AA Change: *265R
SMART Domains Protein: ENSMUSP00000075821
Gene: ENSMUSG00000063163
AA Change: *265R

DomainStartEndE-ValueType
Pfam:Takusan 51 137 6.3e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164146
SMART Domains Protein: ENSMUSP00000126059
Gene: ENSMUSG00000063163

DomainStartEndE-ValueType
Pfam:Takusan 33 121 1.9e-33 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000166256
SMART Domains Protein: ENSMUSP00000130270
Gene: ENSMUSG00000063163

DomainStartEndE-ValueType
Pfam:Takusan 1 49 2.3e-14 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.5%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb A T 10: 10,395,310 F863Y probably damaging Het
Akap12 A G 10: 4,353,847 E219G probably benign Het
Akr1c20 G A 13: 4,514,400 T38I possibly damaging Het
Ap5z1 C A 5: 142,474,500 S511R probably benign Het
Arhgap11a T A 2: 113,834,102 H612L possibly damaging Het
Atp2b2 G T 6: 113,817,192 S118Y probably damaging Het
Boc A T 16: 44,520,473 M38K probably benign Het
Ccdc171 A T 4: 83,681,244 E773D possibly damaging Het
Dmtn C T 14: 70,612,658 probably benign Het
Dnah10 G A 5: 124,755,823 probably benign Het
Efcab1 A G 16: 14,924,137 M212V probably benign Het
Fam83b T C 9: 76,503,076 N184S probably benign Het
Fam98c A G 7: 29,152,840 M98T probably damaging Het
Fbn1 T C 2: 125,301,609 K2867E probably benign Het
Fsip2 A T 2: 82,989,763 E5280V possibly damaging Het
Fuom T C 7: 140,099,718 probably benign Het
Gm3476 A T 14: 6,118,512 S204T probably benign Het
Grhl3 A G 4: 135,561,306 F23L probably benign Het
Il4i1 G T 7: 44,839,789 R334L probably damaging Het
Ipo13 A G 4: 117,901,031 S712P probably damaging Het
Lama4 G T 10: 39,056,847 S573I probably damaging Het
Lrp11 A G 10: 7,604,294 H371R probably benign Het
Mkln1 T A 6: 31,489,368 I520N probably damaging Het
Nagpa G T 16: 5,198,616 C236* probably null Het
Nktr A G 9: 121,727,370 N38S probably damaging Het
Nlrp10 G A 7: 108,925,881 R131C probably benign Het
Nxpe2 T C 9: 48,319,911 D386G possibly damaging Het
Prpf39 T A 12: 65,053,966 probably benign Het
Retreg2 A G 1: 75,145,111 probably benign Het
S100a4 G T 3: 90,605,777 S60I possibly damaging Het
Slc12a3 G T 8: 94,333,277 G184C probably damaging Het
Slc25a46 C T 18: 31,609,754 D20N possibly damaging Het
Smc3 A G 19: 53,634,078 K695E probably benign Het
Taar4 T G 10: 23,961,038 V182G possibly damaging Het
Ttll1 C G 15: 83,502,125 S93T probably benign Het
Ubl3 A T 5: 148,506,198 probably null Het
Vmn2r16 A G 5: 109,360,777 N457S probably benign Het
Vmn2r72 T C 7: 85,749,188 E528G probably benign Het
Zfp52 A C 17: 21,560,049 E53A probably damaging Het
Other mutations in Speer2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Speer2 APN 16 69860518 missense probably benign 0.01
IGL01115:Speer2 APN 16 69861651 nonsense probably null
IGL01694:Speer2 APN 16 69858112 missense probably damaging 0.98
IGL01694:Speer2 APN 16 69858113 missense probably damaging 1.00
IGL02738:Speer2 APN 16 69861712 missense probably benign
IGL03024:Speer2 APN 16 69858115 missense possibly damaging 0.95
IGL03062:Speer2 APN 16 69857977 missense probably damaging 0.96
R0054:Speer2 UTSW 16 69858752 missense probably damaging 0.99
R1952:Speer2 UTSW 16 69857164 missense probably damaging 0.96
R1993:Speer2 UTSW 16 69858077 missense probably benign 0.01
R1995:Speer2 UTSW 16 69858077 missense probably benign 0.01
R2063:Speer2 UTSW 16 69860497 missense probably benign 0.02
R2155:Speer2 UTSW 16 69860597 missense possibly damaging 0.63
R2216:Speer2 UTSW 16 69858842 missense possibly damaging 0.94
R4547:Speer2 UTSW 16 69858849 missense probably damaging 0.98
R4548:Speer2 UTSW 16 69858849 missense probably damaging 0.98
R4625:Speer2 UTSW 16 69858754 nonsense probably null
R4692:Speer2 UTSW 16 69857972 missense possibly damaging 0.91
R4841:Speer2 UTSW 16 69858100 missense probably benign 0.26
R4842:Speer2 UTSW 16 69858100 missense probably benign 0.26
R5035:Speer2 UTSW 16 69857941 critical splice donor site probably null
R5133:Speer2 UTSW 16 69858820 missense probably null 0.06
R5812:Speer2 UTSW 16 69858895 missense possibly damaging 0.82
R6348:Speer2 UTSW 16 69858007 missense possibly damaging 0.83
R6854:Speer2 UTSW 16 69858887 missense probably damaging 0.96
R7446:Speer2 UTSW 16 69858077 missense possibly damaging 0.82
R8068:Speer2 UTSW 16 69860524 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- CCATCAGCACCCTTTCACTGCATATTAA -3'
(R):5'- ACAGCTTGCCAGTCCATGTGTTT -3'

Sequencing Primer
(F):5'- TTAAGTAGTACAGACCTACAGCCTG -3'
(R):5'- AGACCAGTGTTAACTGTCCTG -3'
Posted On2014-01-29