Mutagenetix > Incidental Mutation

Incidental Mutation 'R1248:Speer2'

152208

Institutional Source

Beutler Lab

Gene Symbol

Speer2

Ensembl Gene

ENSMUSG00000063163

Gene Name

spermatogenesis associated glutamate (E)-rich protein 2

Synonyms

SPEER-2

MMRRC Submission

039315-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.083) question?

Stock #

R1248 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

69856874-69863744 bp(-) (GRCm38)

Type of Mutation

splice site (67 bp from exon)

DNA Base Change (assembly)

A to T at 69857067 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000130270 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076500] [ENSMUST00000164146] [ENSMUST00000166256]

AlphaFold

E9Q9U2

Predicted Effect

probably null
Transcript: ENSMUST00000076500
AA Change: *265R

SMART Domains

Protein: ENSMUSP00000075821
Gene: ENSMUSG00000063163
AA Change: *265R

Domain	Start	End	E-Value	Type
Pfam:Takusan	51	137	6.3e-28	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000164146

SMART Domains

Protein: ENSMUSP00000126059
Gene: ENSMUSG00000063163

Domain	Start	End	E-Value	Type
Pfam:Takusan	33	121	1.9e-33	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000166256

SMART Domains

Protein: ENSMUSP00000130270
Gene: ENSMUSG00000063163

Domain	Start	End	E-Value	Type
Pfam:Takusan	1	49	2.3e-14	PFAM

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.6%
20x: 90.5%

Validation Efficiency

98% (43/44)

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgb	A	T	10: 10,395,310	F863Y	probably damaging	Het
Akap12	A	G	10: 4,353,847	E219G	probably benign	Het
Akr1c20	G	A	13: 4,514,400	T38I	possibly damaging	Het
Ap5z1	C	A	5: 142,474,500	S511R	probably benign	Het
Arhgap11a	T	A	2: 113,834,102	H612L	possibly damaging	Het
Atp2b2	G	T	6: 113,817,192	S118Y	probably damaging	Het
Boc	A	T	16: 44,520,473	M38K	probably benign	Het
Ccdc171	A	T	4: 83,681,244	E773D	possibly damaging	Het
Dmtn	C	T	14: 70,612,658		probably benign	Het
Dnah10	G	A	5: 124,755,823		probably benign	Het
Efcab1	A	G	16: 14,924,137	M212V	probably benign	Het
Fam83b	T	C	9: 76,503,076	N184S	probably benign	Het
Fam98c	A	G	7: 29,152,840	M98T	probably damaging	Het
Fbn1	T	C	2: 125,301,609	K2867E	probably benign	Het
Fsip2	A	T	2: 82,989,763	E5280V	possibly damaging	Het
Fuom	T	C	7: 140,099,718		probably benign	Het
Gm3476	A	T	14: 6,118,512	S204T	probably benign	Het
Grhl3	A	G	4: 135,561,306	F23L	probably benign	Het
Il4i1	G	T	7: 44,839,789	R334L	probably damaging	Het
Ipo13	A	G	4: 117,901,031	S712P	probably damaging	Het
Lama4	G	T	10: 39,056,847	S573I	probably damaging	Het
Lrp11	A	G	10: 7,604,294	H371R	probably benign	Het
Mkln1	T	A	6: 31,489,368	I520N	probably damaging	Het
Nagpa	G	T	16: 5,198,616	C236*	probably null	Het
Nktr	A	G	9: 121,727,370	N38S	probably damaging	Het
Nlrp10	G	A	7: 108,925,881	R131C	probably benign	Het
Nxpe2	T	C	9: 48,319,911	D386G	possibly damaging	Het
Prpf39	T	A	12: 65,053,966		probably benign	Het
Retreg2	A	G	1: 75,145,111		probably benign	Het
S100a4	G	T	3: 90,605,777	S60I	possibly damaging	Het
Slc12a3	G	T	8: 94,333,277	G184C	probably damaging	Het
Slc25a46	C	T	18: 31,609,754	D20N	possibly damaging	Het
Smc3	A	G	19: 53,634,078	K695E	probably benign	Het
Taar4	T	G	10: 23,961,038	V182G	possibly damaging	Het
Ttll1	C	G	15: 83,502,125	S93T	probably benign	Het
Ubl3	A	T	5: 148,506,198		probably null	Het
Vmn2r16	A	G	5: 109,360,777	N457S	probably benign	Het
Vmn2r72	T	C	7: 85,749,188	E528G	probably benign	Het
Zfp52	A	C	17: 21,560,049	E53A	probably damaging	Het

Other mutations in Speer2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00693:Speer2	APN	16	69860518	missense	probably benign	0.01
IGL01115:Speer2	APN	16	69861651	nonsense	probably null
IGL01694:Speer2	APN	16	69858112	missense	probably damaging	0.98
IGL01694:Speer2	APN	16	69858113	missense	probably damaging	1.00
IGL02738:Speer2	APN	16	69861712	missense	probably benign
IGL03024:Speer2	APN	16	69858115	missense	possibly damaging	0.95
IGL03062:Speer2	APN	16	69857977	missense	probably damaging	0.96
R0054:Speer2	UTSW	16	69858752	missense	probably damaging	0.99
R1952:Speer2	UTSW	16	69857164	missense	probably damaging	0.96
R1993:Speer2	UTSW	16	69858077	missense	probably benign	0.01
R1995:Speer2	UTSW	16	69858077	missense	probably benign	0.01
R2063:Speer2	UTSW	16	69860497	missense	probably benign	0.02
R2155:Speer2	UTSW	16	69860597	missense	possibly damaging	0.63
R2216:Speer2	UTSW	16	69858842	missense	possibly damaging	0.94
R4547:Speer2	UTSW	16	69858849	missense	probably damaging	0.98
R4548:Speer2	UTSW	16	69858849	missense	probably damaging	0.98
R4625:Speer2	UTSW	16	69858754	nonsense	probably null
R4692:Speer2	UTSW	16	69857972	missense	possibly damaging	0.91
R4841:Speer2	UTSW	16	69858100	missense	probably benign	0.26
R4842:Speer2	UTSW	16	69858100	missense	probably benign	0.26
R5035:Speer2	UTSW	16	69857941	critical splice donor site	probably null
R5133:Speer2	UTSW	16	69858820	missense	probably null	0.06
R5812:Speer2	UTSW	16	69858895	missense	possibly damaging	0.82
R6348:Speer2	UTSW	16	69858007	missense	possibly damaging	0.83
R6854:Speer2	UTSW	16	69858887	missense	probably damaging	0.96
R7446:Speer2	UTSW	16	69858077	missense	possibly damaging	0.82
R8068:Speer2	UTSW	16	69860524	missense	possibly damaging	0.84

Predicted Primers

PCR Primer
(F):5'- CCATCAGCACCCTTTCACTGCATATTAA -3'
(R):5'- ACAGCTTGCCAGTCCATGTGTTT -3'

Sequencing Primer
(F):5'- TTAAGTAGTACAGACCTACAGCCTG -3'
(R):5'- AGACCAGTGTTAACTGTCCTG -3'

Posted On

2014-01-29