Incidental Mutation 'R1248:Zfp52'
ID152209
Institutional Source Beutler Lab
Gene Symbol Zfp52
Ensembl Gene ENSMUSG00000051341
Gene Namezinc finger protein 52
SynonymsKRAB11, Zfp-52, zfec29, Zfp76
MMRRC Submission 039315-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.183) question?
Stock #R1248 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location21555046-21562066 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 21560049 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 53 (E53A)
Ref Sequence ENSEMBL: ENSMUSP00000078233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079242]
Predicted Effect probably damaging
Transcript: ENSMUST00000079242
AA Change: E53A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078233
Gene: ENSMUSG00000051341
AA Change: E53A

DomainStartEndE-ValueType
KRAB 13 73 3.79e-24 SMART
ZnF_C2H2 186 208 1.79e-2 SMART
ZnF_C2H2 214 236 5.07e0 SMART
ZnF_C2H2 242 264 2.29e1 SMART
ZnF_C2H2 270 292 2.36e-2 SMART
ZnF_C2H2 298 320 4.72e-2 SMART
ZnF_C2H2 326 348 1.77e1 SMART
ZnF_C2H2 382 404 1.12e-3 SMART
ZnF_C2H2 410 432 1.34e2 SMART
ZnF_C2H2 438 460 1.06e-4 SMART
ZnF_C2H2 466 488 6.99e-5 SMART
ZnF_C2H2 494 516 4.17e-3 SMART
ZnF_C2H2 522 544 5.5e-3 SMART
ZnF_C2H2 550 572 8.47e-4 SMART
ZnF_C2H2 578 600 1.01e-1 SMART
ZnF_C2H2 606 628 9.73e-4 SMART
ZnF_C2H2 634 656 4.17e-3 SMART
ZnF_C2H2 662 684 6.32e-3 SMART
ZnF_C2H2 690 712 1.69e-3 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.5%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb A T 10: 10,395,310 F863Y probably damaging Het
Akap12 A G 10: 4,353,847 E219G probably benign Het
Akr1c20 G A 13: 4,514,400 T38I possibly damaging Het
Ap5z1 C A 5: 142,474,500 S511R probably benign Het
Arhgap11a T A 2: 113,834,102 H612L possibly damaging Het
Atp2b2 G T 6: 113,817,192 S118Y probably damaging Het
Boc A T 16: 44,520,473 M38K probably benign Het
Ccdc171 A T 4: 83,681,244 E773D possibly damaging Het
Dmtn C T 14: 70,612,658 probably benign Het
Dnah10 G A 5: 124,755,823 probably benign Het
Efcab1 A G 16: 14,924,137 M212V probably benign Het
Fam83b T C 9: 76,503,076 N184S probably benign Het
Fam98c A G 7: 29,152,840 M98T probably damaging Het
Fbn1 T C 2: 125,301,609 K2867E probably benign Het
Fsip2 A T 2: 82,989,763 E5280V possibly damaging Het
Fuom T C 7: 140,099,718 probably benign Het
Gm3476 A T 14: 6,118,512 S204T probably benign Het
Grhl3 A G 4: 135,561,306 F23L probably benign Het
Il4i1 G T 7: 44,839,789 R334L probably damaging Het
Ipo13 A G 4: 117,901,031 S712P probably damaging Het
Lama4 G T 10: 39,056,847 S573I probably damaging Het
Lrp11 A G 10: 7,604,294 H371R probably benign Het
Mkln1 T A 6: 31,489,368 I520N probably damaging Het
Nagpa G T 16: 5,198,616 C236* probably null Het
Nktr A G 9: 121,727,370 N38S probably damaging Het
Nlrp10 G A 7: 108,925,881 R131C probably benign Het
Nxpe2 T C 9: 48,319,911 D386G possibly damaging Het
Prpf39 T A 12: 65,053,966 probably benign Het
Retreg2 A G 1: 75,145,111 probably benign Het
S100a4 G T 3: 90,605,777 S60I possibly damaging Het
Slc12a3 G T 8: 94,333,277 G184C probably damaging Het
Slc25a46 C T 18: 31,609,754 D20N possibly damaging Het
Smc3 A G 19: 53,634,078 K695E probably benign Het
Speer2 A T 16: 69,857,067 probably null Het
Taar4 T G 10: 23,961,038 V182G possibly damaging Het
Ttll1 C G 15: 83,502,125 S93T probably benign Het
Ubl3 A T 5: 148,506,198 probably null Het
Vmn2r16 A G 5: 109,360,777 N457S probably benign Het
Vmn2r72 T C 7: 85,749,188 E528G probably benign Het
Other mutations in Zfp52
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01752:Zfp52 APN 17 21560150 missense probably benign 0.12
PIT4449001:Zfp52 UTSW 17 21557216 missense probably damaging 1.00
R0270:Zfp52 UTSW 17 21561302 missense probably damaging 1.00
R0674:Zfp52 UTSW 17 21561846 missense probably damaging 1.00
R1224:Zfp52 UTSW 17 21555062 missense possibly damaging 0.70
R1622:Zfp52 UTSW 17 21561571 missense probably benign 0.00
R1663:Zfp52 UTSW 17 21561822 missense possibly damaging 0.59
R1917:Zfp52 UTSW 17 21560164 missense probably benign
R4272:Zfp52 UTSW 17 21560197 nonsense probably null
R4273:Zfp52 UTSW 17 21560197 nonsense probably null
R4278:Zfp52 UTSW 17 21561870 missense probably benign
R4683:Zfp52 UTSW 17 21561507 missense probably benign 0.31
R4865:Zfp52 UTSW 17 21561243 missense probably damaging 1.00
R4964:Zfp52 UTSW 17 21560403 missense probably benign 0.04
R4966:Zfp52 UTSW 17 21560403 missense probably benign 0.04
R5430:Zfp52 UTSW 17 21555067 missense probably benign 0.01
R5685:Zfp52 UTSW 17 21561751 missense probably benign 0.15
R6133:Zfp52 UTSW 17 21560471 missense probably damaging 1.00
R6882:Zfp52 UTSW 17 21555047 start codon destroyed probably null 1.00
R7083:Zfp52 UTSW 17 21560130 missense possibly damaging 0.86
R7439:Zfp52 UTSW 17 21560870 nonsense probably null
R7456:Zfp52 UTSW 17 21561353 missense probably damaging 1.00
R7740:Zfp52 UTSW 17 21560990 missense probably damaging 1.00
R8196:Zfp52 UTSW 17 21561894 missense possibly damaging 0.45
Predicted Primers PCR Primer
(F):5'- GCGCAATAGCTGCCCATGAAAG -3'
(R):5'- TCTGCGTTTGATGAGTCAACAGAGG -3'

Sequencing Primer
(F):5'- GACCCTAAGATTCGATGAAAGTCTTC -3'
(R):5'- AGAGGCATCCTTCTCATTACAG -3'
Posted On2014-01-29