Incidental Mutation 'R1226:Ccdc187'
ID152214
Institutional Source Beutler Lab
Gene Symbol Ccdc187
Ensembl Gene ENSMUSG00000048038
Gene Namecoiled-coil domain containing 187
Synonyms4932418E24Rik
MMRRC Submission 039295-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R1226 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location26243469-26294557 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 26276121 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 765 (S765R)
Ref Sequence ENSEMBL: ENSMUSP00000054283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057224] [ENSMUST00000217256] [ENSMUST00000227200]
Predicted Effect probably damaging
Transcript: ENSMUST00000057224
AA Change: S765R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000054283
Gene: ENSMUSG00000048038
AA Change: S765R

DomainStartEndE-ValueType
low complexity region 116 132 N/A INTRINSIC
low complexity region 536 557 N/A INTRINSIC
coiled coil region 605 632 N/A INTRINSIC
coiled coil region 717 745 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000217256
AA Change: S765R
Predicted Effect unknown
Transcript: ENSMUST00000227200
AA Change: S804R
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Abcd2 G T 15: 91,191,043 A189E probably benign Het
Ahcy T C 2: 155,064,897 T159A probably benign Het
Arfgef2 T C 2: 166,827,640 V84A probably damaging Het
Brwd1 G A 16: 96,031,548 T1036M probably benign Het
Ccdc173 A G 2: 69,787,209 M76T possibly damaging Het
Chd1l G A 3: 97,562,625 R862* probably null Het
Crmp1 A G 5: 37,273,434 D71G probably damaging Het
Ctif CTGTGTCCGGTGT CTGT 18: 75,521,579 probably benign Het
Ctsb A C 14: 63,141,740 Y267S probably damaging Het
Cyp4a12b T A 4: 115,432,967 I239N possibly damaging Het
Dna2 T C 10: 62,960,424 V544A possibly damaging Het
Dnhd1 T A 7: 105,696,899 F2364Y probably damaging Het
Fsip2 A T 2: 82,981,011 E2558V probably damaging Het
Gm10061 A C 16: 89,151,281 Y48S unknown Het
Herc1 T A 9: 66,416,263 M1353K probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lin7a T C 10: 107,271,919 V20A probably benign Het
Lsr T A 7: 30,971,883 I142F probably damaging Het
Mei1 C T 15: 82,080,084 T275I possibly damaging Het
Mon2 A G 10: 123,002,819 V1593A probably benign Het
Mrpl32 A G 13: 14,611,511 I74T probably benign Het
Nek11 C T 9: 105,392,892 V44I probably damaging Het
Noa1 A G 5: 77,307,555 V438A possibly damaging Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr262 A C 19: 12,241,586 I25R probably benign Het
Olfr828 C T 9: 18,815,970 C108Y probably benign Het
Pcdhb17 T C 18: 37,487,260 L701P probably damaging Het
Pde11a G A 2: 76,158,354 S481L probably benign Het
Prkdc T C 16: 15,673,997 I602T possibly damaging Het
Ptprh T A 7: 4,603,092 R3* probably null Het
Reln A G 5: 21,910,866 L3048P probably damaging Het
Slc6a11 T A 6: 114,194,663 I265N possibly damaging Het
Sorbs2 T C 8: 45,795,619 S636P probably damaging Het
Supt5 T C 7: 28,328,747 I44V probably benign Het
Tdrd6 T A 17: 43,626,632 E1175V possibly damaging Het
Tnxb A C 17: 34,688,929 T1316P probably damaging Het
Ufc1 A C 1: 171,289,237 D119E probably benign Het
Vmn1r220 A G 13: 23,184,124 F134S probably damaging Het
Zfp106 A G 2: 120,524,079 S1404P probably damaging Het
Zfp866 A G 8: 69,766,290 F227L probably damaging Het
Zfyve28 A T 5: 34,217,064 H535Q probably benign Het
Other mutations in Ccdc187
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01868:Ccdc187 APN 2 26280948 missense probably benign
IGL02989:Ccdc187 APN 2 26276431 missense possibly damaging 0.92
IGL03017:Ccdc187 APN 2 26280966 missense probably benign
IGL03059:Ccdc187 APN 2 26294241 missense probably null 1.00
IGL03117:Ccdc187 APN 2 26287968 missense possibly damaging 0.95
R0026:Ccdc187 UTSW 2 26281353 missense probably benign 0.00
R0144:Ccdc187 UTSW 2 26276203 missense probably damaging 0.98
R1078:Ccdc187 UTSW 2 26294377 missense probably damaging 0.98
R1624:Ccdc187 UTSW 2 26281075 missense probably benign
R1733:Ccdc187 UTSW 2 26293658 missense possibly damaging 0.93
R1851:Ccdc187 UTSW 2 26276068 missense probably benign 0.17
R2304:Ccdc187 UTSW 2 26281017 missense possibly damaging 0.94
R4278:Ccdc187 UTSW 2 26282227 intron probably benign
R4344:Ccdc187 UTSW 2 26280669 missense probably damaging 1.00
R5151:Ccdc187 UTSW 2 26293439 missense probably damaging 1.00
R5416:Ccdc187 UTSW 2 26276092 missense possibly damaging 0.87
R5537:Ccdc187 UTSW 2 26276225 missense probably benign 0.32
R5761:Ccdc187 UTSW 2 26276092 missense possibly damaging 0.87
R5762:Ccdc187 UTSW 2 26276092 missense possibly damaging 0.87
R5865:Ccdc187 UTSW 2 26293368 missense probably benign 0.00
R5925:Ccdc187 UTSW 2 26293581 missense probably benign
R6261:Ccdc187 UTSW 2 26276203 missense probably damaging 0.98
R6803:Ccdc187 UTSW 2 26289779 missense probably benign 0.02
R6888:Ccdc187 UTSW 2 26289734 missense probably damaging 0.98
R6958:Ccdc187 UTSW 2 26289719 missense probably benign
R7006:Ccdc187 UTSW 2 26281090 missense probably benign 0.05
R7358:Ccdc187 UTSW 2 26255995 missense probably damaging 0.97
R7818:Ccdc187 UTSW 2 26276174 missense possibly damaging 0.61
R8048:Ccdc187 UTSW 2 26293514 missense possibly damaging 0.53
Z1176:Ccdc187 UTSW 2 26281507 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ACAGGCATGACACCCATTGTCC -3'
(R):5'- TCCTGCACTTCCAGTACAAGCAAG -3'

Sequencing Primer
(F):5'- CTTTCAATGTGGGTCCCCAGG -3'
(R):5'- TCAGGCAACGTGTTGACA -3'
Posted On2014-01-29