Incidental Mutation 'R1226:Ccdc173'
ID152215
Institutional Source Beutler Lab
Gene Symbol Ccdc173
Ensembl Gene ENSMUSG00000070883
Gene Namecoiled-coil domain containing 173
Synonyms4930525K21Rik, 4930578N16Rik
MMRRC Submission 039295-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R1226 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location69758033-69789575 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69787209 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 76 (M76T)
Ref Sequence ENSEMBL: ENSMUSP00000092548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028494] [ENSMUST00000094942] [ENSMUST00000112266] [ENSMUST00000151298] [ENSMUST00000180290]
Predicted Effect probably benign
Transcript: ENSMUST00000028494
SMART Domains Protein: ENSMUSP00000028494
Gene: ENSMUSG00000027088

DomainStartEndE-ValueType
Pfam:Put_Phosphatase 3 239 1.2e-98 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000094942
AA Change: M76T

PolyPhen 2 Score 0.629 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000092548
Gene: ENSMUSG00000070883
AA Change: M76T

DomainStartEndE-ValueType
coiled coil region 47 131 N/A INTRINSIC
Pfam:TPH 142 475 8.9e-22 PFAM
low complexity region 494 508 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112266
SMART Domains Protein: ENSMUSP00000107885
Gene: ENSMUSG00000027088

DomainStartEndE-ValueType
Pfam:Put_Phosphatase 3 239 9.3e-99 PFAM
Pfam:HAD_2 5 128 8.9e-7 PFAM
Pfam:HAD 5 187 3.2e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128765
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131100
Predicted Effect probably benign
Transcript: ENSMUST00000151298
SMART Domains Protein: ENSMUSP00000118021
Gene: ENSMUSG00000027088

DomainStartEndE-ValueType
Pfam:Put_Phosphatase 3 51 2.9e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180290
SMART Domains Protein: ENSMUSP00000136471
Gene: ENSMUSG00000027088

DomainStartEndE-ValueType
Pfam:Put_Phosphatase 3 239 9.3e-99 PFAM
Pfam:HAD_2 5 128 8.9e-7 PFAM
Pfam:HAD 5 187 3.2e-15 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Abcd2 G T 15: 91,191,043 A189E probably benign Het
Ahcy T C 2: 155,064,897 T159A probably benign Het
Arfgef2 T C 2: 166,827,640 V84A probably damaging Het
Brwd1 G A 16: 96,031,548 T1036M probably benign Het
Ccdc187 G T 2: 26,276,121 S765R probably damaging Het
Chd1l G A 3: 97,562,625 R862* probably null Het
Crmp1 A G 5: 37,273,434 D71G probably damaging Het
Ctif CTGTGTCCGGTGT CTGT 18: 75,521,579 probably benign Het
Ctsb A C 14: 63,141,740 Y267S probably damaging Het
Cyp4a12b T A 4: 115,432,967 I239N possibly damaging Het
Dna2 T C 10: 62,960,424 V544A possibly damaging Het
Dnhd1 T A 7: 105,696,899 F2364Y probably damaging Het
Fsip2 A T 2: 82,981,011 E2558V probably damaging Het
Gm10061 A C 16: 89,151,281 Y48S unknown Het
Herc1 T A 9: 66,416,263 M1353K probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lin7a T C 10: 107,271,919 V20A probably benign Het
Lsr T A 7: 30,971,883 I142F probably damaging Het
Mei1 C T 15: 82,080,084 T275I possibly damaging Het
Mon2 A G 10: 123,002,819 V1593A probably benign Het
Mrpl32 A G 13: 14,611,511 I74T probably benign Het
Nek11 C T 9: 105,392,892 V44I probably damaging Het
Noa1 A G 5: 77,307,555 V438A possibly damaging Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr262 A C 19: 12,241,586 I25R probably benign Het
Olfr828 C T 9: 18,815,970 C108Y probably benign Het
Pcdhb17 T C 18: 37,487,260 L701P probably damaging Het
Pde11a G A 2: 76,158,354 S481L probably benign Het
Prkdc T C 16: 15,673,997 I602T possibly damaging Het
Ptprh T A 7: 4,603,092 R3* probably null Het
Reln A G 5: 21,910,866 L3048P probably damaging Het
Slc6a11 T A 6: 114,194,663 I265N possibly damaging Het
Sorbs2 T C 8: 45,795,619 S636P probably damaging Het
Supt5 T C 7: 28,328,747 I44V probably benign Het
Tdrd6 T A 17: 43,626,632 E1175V possibly damaging Het
Tnxb A C 17: 34,688,929 T1316P probably damaging Het
Ufc1 A C 1: 171,289,237 D119E probably benign Het
Vmn1r220 A G 13: 23,184,124 F134S probably damaging Het
Zfp106 A G 2: 120,524,079 S1404P probably damaging Het
Zfp866 A G 8: 69,766,290 F227L probably damaging Het
Zfyve28 A T 5: 34,217,064 H535Q probably benign Het
Other mutations in Ccdc173
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Ccdc173 APN 2 69771984 missense probably benign
IGL01768:Ccdc173 APN 2 69782127 splice site probably benign
IGL01801:Ccdc173 APN 2 69776279 splice site probably benign
R0553:Ccdc173 UTSW 2 69789441 missense probably damaging 1.00
R1867:Ccdc173 UTSW 2 69781837 splice site probably null
R4821:Ccdc173 UTSW 2 69782108 missense possibly damaging 0.76
R5309:Ccdc173 UTSW 2 69787258 missense possibly damaging 0.92
R5312:Ccdc173 UTSW 2 69787258 missense possibly damaging 0.92
R5916:Ccdc173 UTSW 2 69789462 start codon destroyed probably null 0.95
R6072:Ccdc173 UTSW 2 69772058 missense probably benign 0.31
R6232:Ccdc173 UTSW 2 69772054 missense possibly damaging 0.64
R6236:Ccdc173 UTSW 2 69758041 utr 3 prime probably null
R6909:Ccdc173 UTSW 2 69781848 intron probably null
R7497:Ccdc173 UTSW 2 69758448 missense probably benign 0.04
R7502:Ccdc173 UTSW 2 69776144 missense probably benign
R7786:Ccdc173 UTSW 2 69781748 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTGACCTGCTCATTTCTAAGGAGG -3'
(R):5'- TCCCACAAAGTTCAATGTCTTGCCC -3'

Sequencing Primer
(F):5'- CTAAGCTTTTAGGTGATGAGCAC -3'
(R):5'- GTCAGGTGAACTCTTCCTGAAAAG -3'
Posted On2014-01-29