Incidental Mutation 'R1226:Ahcy'
ID152219
Institutional Source Beutler Lab
Gene Symbol Ahcy
Ensembl Gene ENSMUSG00000027597
Gene NameS-adenosylhomocysteine hydrolase
SynonymsCuBP, SAHH
MMRRC Submission 039295-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1226 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location155059310-155074497 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 155064897 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 159 (T159A)
Ref Sequence ENSEMBL: ENSMUSP00000061851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054607] [ENSMUST00000137242]
Predicted Effect probably benign
Transcript: ENSMUST00000054607
AA Change: T159A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000061851
Gene: ENSMUSG00000027597
AA Change: T159A

DomainStartEndE-ValueType
AdoHcyase 6 431 N/A SMART
AdoHcyase_NAD 191 352 1.49e-118 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137242
SMART Domains Protein: ENSMUSP00000116774
Gene: ENSMUSG00000027597

DomainStartEndE-ValueType
Pfam:AdoHcyase 5 95 1.4e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146367
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] S-adenosylhomocysteine hydrolase belongs to the adenosylhomocysteinase family. It catalyzes the reversible hydrolysis of S-adenosylhomocysteine (AdoHcy) to adenosine (Ado) and L-homocysteine (Hcy). Thus, it regulates the intracellular S-adenosylhomocysteine (SAH) concentration thought to be important for transmethylation reactions. Deficiency in this protein is one of the different causes of hypermethioninemia. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2009]
PHENOTYPE: See the ax allele for a deletion that includes the Ahcy gene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Abcd2 G T 15: 91,191,043 A189E probably benign Het
Arfgef2 T C 2: 166,827,640 V84A probably damaging Het
Brwd1 G A 16: 96,031,548 T1036M probably benign Het
Ccdc173 A G 2: 69,787,209 M76T possibly damaging Het
Ccdc187 G T 2: 26,276,121 S765R probably damaging Het
Chd1l G A 3: 97,562,625 R862* probably null Het
Crmp1 A G 5: 37,273,434 D71G probably damaging Het
Ctif CTGTGTCCGGTGT CTGT 18: 75,521,579 probably benign Het
Ctsb A C 14: 63,141,740 Y267S probably damaging Het
Cyp4a12b T A 4: 115,432,967 I239N possibly damaging Het
Dna2 T C 10: 62,960,424 V544A possibly damaging Het
Dnhd1 T A 7: 105,696,899 F2364Y probably damaging Het
Fsip2 A T 2: 82,981,011 E2558V probably damaging Het
Gm10061 A C 16: 89,151,281 Y48S unknown Het
Herc1 T A 9: 66,416,263 M1353K probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lin7a T C 10: 107,271,919 V20A probably benign Het
Lsr T A 7: 30,971,883 I142F probably damaging Het
Mei1 C T 15: 82,080,084 T275I possibly damaging Het
Mon2 A G 10: 123,002,819 V1593A probably benign Het
Mrpl32 A G 13: 14,611,511 I74T probably benign Het
Nek11 C T 9: 105,392,892 V44I probably damaging Het
Noa1 A G 5: 77,307,555 V438A possibly damaging Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr262 A C 19: 12,241,586 I25R probably benign Het
Olfr828 C T 9: 18,815,970 C108Y probably benign Het
Pcdhb17 T C 18: 37,487,260 L701P probably damaging Het
Pde11a G A 2: 76,158,354 S481L probably benign Het
Prkdc T C 16: 15,673,997 I602T possibly damaging Het
Ptprh T A 7: 4,603,092 R3* probably null Het
Reln A G 5: 21,910,866 L3048P probably damaging Het
Slc6a11 T A 6: 114,194,663 I265N possibly damaging Het
Sorbs2 T C 8: 45,795,619 S636P probably damaging Het
Supt5 T C 7: 28,328,747 I44V probably benign Het
Tdrd6 T A 17: 43,626,632 E1175V possibly damaging Het
Tnxb A C 17: 34,688,929 T1316P probably damaging Het
Ufc1 A C 1: 171,289,237 D119E probably benign Het
Vmn1r220 A G 13: 23,184,124 F134S probably damaging Het
Zfp106 A G 2: 120,524,079 S1404P probably damaging Het
Zfp866 A G 8: 69,766,290 F227L probably damaging Het
Zfyve28 A T 5: 34,217,064 H535Q probably benign Het
Other mutations in Ahcy
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01105:Ahcy APN 2 155067361 missense probably benign 0.26
IGL03001:Ahcy APN 2 155064828 missense probably damaging 1.00
F5770:Ahcy UTSW 2 155064921 nonsense probably null
R1572:Ahcy UTSW 2 155068931 missense probably benign 0.06
R1741:Ahcy UTSW 2 155064234 missense probably benign 0.29
R1879:Ahcy UTSW 2 155064152 critical splice donor site probably null
R1898:Ahcy UTSW 2 155062253 missense probably benign 0.20
R4743:Ahcy UTSW 2 155068968 missense probably damaging 1.00
R4861:Ahcy UTSW 2 155060516 missense probably benign 0.05
R4861:Ahcy UTSW 2 155060516 missense probably benign 0.05
R6114:Ahcy UTSW 2 155062159 missense probably damaging 1.00
R7107:Ahcy UTSW 2 155068973 missense probably damaging 0.98
V7582:Ahcy UTSW 2 155064921 nonsense probably null
X0067:Ahcy UTSW 2 155068952 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAAGCCATGATACCTGAAGCAGC -3'
(R):5'- AGAGTGCATCAGATGACACCTCCC -3'

Sequencing Primer
(F):5'- GACTAAGTAAGAGCTTCATGTCCC -3'
(R):5'- TGACACCTCCCTGGGTGAC -3'
Posted On2014-01-29