Incidental Mutation 'R1226:Kirrel1'
ID 152221
Institutional Source Beutler Lab
Gene Symbol Kirrel1
Ensembl Gene ENSMUSG00000041734
Gene Name kirre like nephrin family adhesion molecule 1
Synonyms 6720469N11Rik, Neph1, Kirrel1, Kirrel
MMRRC Submission 039295-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1226 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 86985900-87082054 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 86996458 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 380 (M380I)
Ref Sequence ENSEMBL: ENSMUSP00000125525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041732] [ENSMUST00000107618] [ENSMUST00000159976]
AlphaFold Q80W68
Predicted Effect probably null
Transcript: ENSMUST00000041732
AA Change: M380I

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000043756
Gene: ENSMUSG00000041734
AA Change: M380I

DomainStartEndE-ValueType
IG 59 149 3.62e-10 SMART
IG_like 160 252 1.27e1 SMART
IG_like 261 337 1.89e1 SMART
IGc2 352 410 3.28e-8 SMART
IG_like 430 522 5.71e0 SMART
transmembrane domain 529 551 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107618
AA Change: M380I

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103243
Gene: ENSMUSG00000041734
AA Change: M380I

DomainStartEndE-ValueType
IG 59 149 3.62e-10 SMART
IG_like 160 252 1.27e1 SMART
IG_like 261 337 1.89e1 SMART
IGc2 352 410 3.28e-8 SMART
IG_like 430 522 5.71e0 SMART
transmembrane domain 529 551 N/A INTRINSIC
low complexity region 694 712 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000159976
AA Change: M380I

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000125525
Gene: ENSMUSG00000041734
AA Change: M380I

DomainStartEndE-ValueType
IG 59 149 3.62e-10 SMART
IG_like 160 252 1.27e1 SMART
IG_like 261 337 1.89e1 SMART
IGc2 352 410 3.28e-8 SMART
IG_like 430 522 5.71e0 SMART
transmembrane domain 529 551 N/A INTRINSIC
low complexity region 694 712 N/A INTRINSIC
Meta Mutation Damage Score 0.0922 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NEPH1 is a member of the nephrin-like protein family, which includes NEPH2 (MIM 607761) and NEPH3 (MIM 607762). The cytoplasmic domains of these proteins interact with the C terminus of podocin (NPHS2; MIM 604766), and the genes are expressed in kidney podocytes, cells involved in ensuring size- and charge-selective ultrafiltration (Sellin et al., 2003 [PubMed 12424224]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap insertion exhibit postnatal lethality and are small and sickly. Glomerular and tubular defects in the kidney result in severe proteinuria. [provided by MGI curators]
Allele List at MGI

All alleles(121) : Targeted, other(2) Gene trapped(119)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 124,688,791 (GRCm39) G495D probably damaging Het
Abcd2 G T 15: 91,075,246 (GRCm39) A189E probably benign Het
Ahcy T C 2: 154,906,817 (GRCm39) T159A probably benign Het
Arfgef2 T C 2: 166,669,560 (GRCm39) V84A probably damaging Het
Brwd1 G A 16: 95,832,748 (GRCm39) T1036M probably benign Het
Ccdc187 G T 2: 26,166,133 (GRCm39) S765R probably damaging Het
Cfap210 A G 2: 69,617,553 (GRCm39) M76T possibly damaging Het
Chd1l G A 3: 97,469,941 (GRCm39) R862* probably null Het
Crmp1 A G 5: 37,430,778 (GRCm39) D71G probably damaging Het
Ctif CTGTGTCCGGTGT CTGT 18: 75,654,650 (GRCm39) probably benign Het
Ctsb A C 14: 63,379,189 (GRCm39) Y267S probably damaging Het
Cyp4a12b T A 4: 115,290,164 (GRCm39) I239N possibly damaging Het
Dna2 T C 10: 62,796,203 (GRCm39) V544A possibly damaging Het
Dnhd1 T A 7: 105,346,106 (GRCm39) F2364Y probably damaging Het
Fsip2 A T 2: 82,811,355 (GRCm39) E2558V probably damaging Het
Gm10061 A C 16: 88,948,169 (GRCm39) Y48S unknown Het
Herc1 T A 9: 66,323,545 (GRCm39) M1353K probably benign Het
Lin7a T C 10: 107,107,780 (GRCm39) V20A probably benign Het
Lsr T A 7: 30,671,308 (GRCm39) I142F probably damaging Het
Mei1 C T 15: 81,964,285 (GRCm39) T275I possibly damaging Het
Mon2 A G 10: 122,838,724 (GRCm39) V1593A probably benign Het
Mrpl32 A G 13: 14,786,096 (GRCm39) I74T probably benign Het
Nek11 C T 9: 105,270,091 (GRCm39) V44I probably damaging Het
Noa1 A G 5: 77,455,402 (GRCm39) V438A possibly damaging Het
Or5an1c A C 19: 12,218,950 (GRCm39) I25R probably benign Het
Or7g16 C T 9: 18,727,266 (GRCm39) C108Y probably benign Het
Or8g18 G C 9: 39,149,547 (GRCm39) P58A probably benign Het
Pcdhb17 T C 18: 37,620,313 (GRCm39) L701P probably damaging Het
Pde11a G A 2: 75,988,698 (GRCm39) S481L probably benign Het
Prkdc T C 16: 15,491,861 (GRCm39) I602T possibly damaging Het
Ptprh T A 7: 4,606,091 (GRCm39) R3* probably null Het
Reln A G 5: 22,115,864 (GRCm39) L3048P probably damaging Het
Slc6a11 T A 6: 114,171,624 (GRCm39) I265N possibly damaging Het
Sorbs2 T C 8: 46,248,656 (GRCm39) S636P probably damaging Het
Supt5 T C 7: 28,028,172 (GRCm39) I44V probably benign Het
Tdrd6 T A 17: 43,937,523 (GRCm39) E1175V possibly damaging Het
Tnxb A C 17: 34,907,903 (GRCm39) T1316P probably damaging Het
Ufc1 A C 1: 171,116,810 (GRCm39) D119E probably benign Het
Vmn1r220 A G 13: 23,368,294 (GRCm39) F134S probably damaging Het
Zfp106 A G 2: 120,354,560 (GRCm39) S1404P probably damaging Het
Zfp866 A G 8: 70,218,940 (GRCm39) F227L probably damaging Het
Zfyve28 A T 5: 34,374,408 (GRCm39) H535Q probably benign Het
Other mutations in Kirrel1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Kirrel1 APN 3 86,997,182 (GRCm39) missense probably benign 0.22
IGL01865:Kirrel1 APN 3 86,993,731 (GRCm39) missense probably damaging 1.00
IGL01875:Kirrel1 APN 3 87,003,037 (GRCm39) missense probably damaging 1.00
IGL02337:Kirrel1 APN 3 86,996,519 (GRCm39) missense possibly damaging 0.64
IGL02724:Kirrel1 APN 3 86,997,780 (GRCm39) nonsense probably null
IGL02825:Kirrel1 APN 3 86,996,595 (GRCm39) splice site probably benign
IGL02826:Kirrel1 APN 3 86,995,792 (GRCm39) missense probably damaging 1.00
IGL03102:Kirrel1 APN 3 86,990,807 (GRCm39) missense probably damaging 0.98
D4043:Kirrel1 UTSW 3 86,990,510 (GRCm39) missense probably benign 0.02
R0360:Kirrel1 UTSW 3 86,997,106 (GRCm39) missense probably damaging 1.00
R0364:Kirrel1 UTSW 3 86,997,106 (GRCm39) missense probably damaging 1.00
R0421:Kirrel1 UTSW 3 86,990,914 (GRCm39) missense probably damaging 0.99
R0503:Kirrel1 UTSW 3 87,005,109 (GRCm39) missense probably benign 0.20
R1112:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1116:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1144:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1147:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1147:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1190:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1501:Kirrel1 UTSW 3 86,997,779 (GRCm39) missense probably benign 0.02
R1538:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1546:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1628:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1630:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1631:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1664:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1671:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1695:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1769:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1807:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1808:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1840:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1876:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1995:Kirrel1 UTSW 3 87,003,093 (GRCm39) missense possibly damaging 0.88
R2014:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R2086:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R2108:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R2354:Kirrel1 UTSW 3 86,995,792 (GRCm39) missense probably damaging 0.98
R2407:Kirrel1 UTSW 3 86,992,150 (GRCm39) missense probably benign 0.03
R2904:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R2905:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R2958:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R2959:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R2960:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R2961:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3026:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3028:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3034:Kirrel1 UTSW 3 86,990,746 (GRCm39) missense possibly damaging 0.56
R3149:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3195:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3196:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3499:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3699:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3720:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3721:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3788:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3793:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3876:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3877:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3901:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3910:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3911:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3912:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3913:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3930:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3931:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4022:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4067:Kirrel1 UTSW 3 86,995,774 (GRCm39) nonsense probably null
R4077:Kirrel1 UTSW 3 86,992,387 (GRCm39) critical splice donor site probably null
R4198:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4328:Kirrel1 UTSW 3 86,992,081 (GRCm39) intron probably benign
R4355:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4363:Kirrel1 UTSW 3 86,997,792 (GRCm39) nonsense probably null
R4378:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4386:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4460:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4468:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4469:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4650:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4652:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4734:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4748:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4749:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R5304:Kirrel1 UTSW 3 86,996,902 (GRCm39) missense probably benign 0.02
R5534:Kirrel1 UTSW 3 86,997,825 (GRCm39) missense probably damaging 1.00
R5604:Kirrel1 UTSW 3 86,996,462 (GRCm39) missense possibly damaging 0.69
R7199:Kirrel1 UTSW 3 86,990,695 (GRCm39) missense probably benign 0.02
R7221:Kirrel1 UTSW 3 86,993,704 (GRCm39) nonsense probably null
R7284:Kirrel1 UTSW 3 86,990,694 (GRCm39) missense probably benign 0.02
R7332:Kirrel1 UTSW 3 86,995,705 (GRCm39) missense probably benign 0.14
R7369:Kirrel1 UTSW 3 87,048,391 (GRCm39) missense probably benign 0.20
R7371:Kirrel1 UTSW 3 86,995,729 (GRCm39) missense probably benign 0.44
R7508:Kirrel1 UTSW 3 86,990,746 (GRCm39) missense possibly damaging 0.56
R7566:Kirrel1 UTSW 3 86,995,791 (GRCm39) missense probably damaging 1.00
R7567:Kirrel1 UTSW 3 87,002,988 (GRCm39) missense probably damaging 0.99
R7621:Kirrel1 UTSW 3 86,995,528 (GRCm39) missense possibly damaging 0.70
R8030:Kirrel1 UTSW 3 87,005,082 (GRCm39) missense probably damaging 1.00
R8141:Kirrel1 UTSW 3 86,993,735 (GRCm39) nonsense probably null
R8261:Kirrel1 UTSW 3 86,995,309 (GRCm39) intron probably benign
R8477:Kirrel1 UTSW 3 86,992,138 (GRCm39) missense possibly damaging 0.71
R8512:Kirrel1 UTSW 3 86,995,534 (GRCm39) missense probably benign 0.00
R8954:Kirrel1 UTSW 3 86,997,173 (GRCm39) missense probably benign 0.25
R8987:Kirrel1 UTSW 3 86,992,400 (GRCm39) missense probably damaging 1.00
R9058:Kirrel1 UTSW 3 86,992,442 (GRCm39) missense probably benign 0.18
R9146:Kirrel1 UTSW 3 87,003,015 (GRCm39) missense probably damaging 1.00
R9311:Kirrel1 UTSW 3 87,005,123 (GRCm39) missense probably benign 0.29
R9527:Kirrel1 UTSW 3 86,996,912 (GRCm39) nonsense probably null
R9629:Kirrel1 UTSW 3 87,003,025 (GRCm39) nonsense probably null
Z1177:Kirrel1 UTSW 3 86,991,182 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTATGGCTGACTGCAAGTACCCTC -3'
(R):5'- GGGACGAAAACTCCACTAACCTGG -3'

Sequencing Primer
(F):5'- GACTGCAAGTACCCTCTTTCC -3'
(R):5'- AGCTGATGATTCTCAGGCAC -3'
Posted On 2014-01-29