Incidental Mutation 'R1226:Cyp4a12b'
ID152223
Institutional Source Beutler Lab
Gene Symbol Cyp4a12b
Ensembl Gene ENSMUSG00000078597
Gene Namecytochrome P450, family 4, subfamily a, polypeptide 12B
Synonyms
MMRRC Submission 039295-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R1226 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location115411624-115439034 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 115432967 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 239 (I239N)
Ref Sequence ENSEMBL: ENSMUSP00000092487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094887]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094887
AA Change: I239N

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000092487
Gene: ENSMUSG00000078597
AA Change: I239N

DomainStartEndE-ValueType
low complexity region 18 39 N/A INTRINSIC
Pfam:p450 51 503 1.9e-132 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Abcd2 G T 15: 91,191,043 A189E probably benign Het
Ahcy T C 2: 155,064,897 T159A probably benign Het
Arfgef2 T C 2: 166,827,640 V84A probably damaging Het
Brwd1 G A 16: 96,031,548 T1036M probably benign Het
Ccdc173 A G 2: 69,787,209 M76T possibly damaging Het
Ccdc187 G T 2: 26,276,121 S765R probably damaging Het
Chd1l G A 3: 97,562,625 R862* probably null Het
Crmp1 A G 5: 37,273,434 D71G probably damaging Het
Ctif CTGTGTCCGGTGT CTGT 18: 75,521,579 probably benign Het
Ctsb A C 14: 63,141,740 Y267S probably damaging Het
Dna2 T C 10: 62,960,424 V544A possibly damaging Het
Dnhd1 T A 7: 105,696,899 F2364Y probably damaging Het
Fsip2 A T 2: 82,981,011 E2558V probably damaging Het
Gm10061 A C 16: 89,151,281 Y48S unknown Het
Herc1 T A 9: 66,416,263 M1353K probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lin7a T C 10: 107,271,919 V20A probably benign Het
Lsr T A 7: 30,971,883 I142F probably damaging Het
Mei1 C T 15: 82,080,084 T275I possibly damaging Het
Mon2 A G 10: 123,002,819 V1593A probably benign Het
Mrpl32 A G 13: 14,611,511 I74T probably benign Het
Nek11 C T 9: 105,392,892 V44I probably damaging Het
Noa1 A G 5: 77,307,555 V438A possibly damaging Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr262 A C 19: 12,241,586 I25R probably benign Het
Olfr828 C T 9: 18,815,970 C108Y probably benign Het
Pcdhb17 T C 18: 37,487,260 L701P probably damaging Het
Pde11a G A 2: 76,158,354 S481L probably benign Het
Prkdc T C 16: 15,673,997 I602T possibly damaging Het
Ptprh T A 7: 4,603,092 R3* probably null Het
Reln A G 5: 21,910,866 L3048P probably damaging Het
Slc6a11 T A 6: 114,194,663 I265N possibly damaging Het
Sorbs2 T C 8: 45,795,619 S636P probably damaging Het
Supt5 T C 7: 28,328,747 I44V probably benign Het
Tdrd6 T A 17: 43,626,632 E1175V possibly damaging Het
Tnxb A C 17: 34,688,929 T1316P probably damaging Het
Ufc1 A C 1: 171,289,237 D119E probably benign Het
Vmn1r220 A G 13: 23,184,124 F134S probably damaging Het
Zfp106 A G 2: 120,524,079 S1404P probably damaging Het
Zfp866 A G 8: 69,766,290 F227L probably damaging Het
Zfyve28 A T 5: 34,217,064 H535Q probably benign Het
Other mutations in Cyp4a12b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Cyp4a12b APN 4 115438049 splice site probably null
IGL01571:Cyp4a12b APN 4 115438157 missense probably benign 0.00
IGL02230:Cyp4a12b APN 4 115433996 missense probably damaging 1.00
IGL02720:Cyp4a12b APN 4 115435171 splice site probably benign
IGL03118:Cyp4a12b APN 4 115432976 missense possibly damaging 0.54
IGL03389:Cyp4a12b APN 4 115433808 missense possibly damaging 0.90
R0360:Cyp4a12b UTSW 4 115432920 missense probably benign 0.01
R0364:Cyp4a12b UTSW 4 115432920 missense probably benign 0.01
R0844:Cyp4a12b UTSW 4 115432524 missense possibly damaging 0.67
R1232:Cyp4a12b UTSW 4 115432563 missense possibly damaging 0.81
R1372:Cyp4a12b UTSW 4 115432949 missense probably benign 0.08
R1559:Cyp4a12b UTSW 4 115433984 missense probably damaging 0.98
R1782:Cyp4a12b UTSW 4 115433981 missense probably damaging 1.00
R1817:Cyp4a12b UTSW 4 115414062 splice site probably benign
R1941:Cyp4a12b UTSW 4 115438059 missense probably damaging 1.00
R1978:Cyp4a12b UTSW 4 115438145 missense probably benign 0.01
R2063:Cyp4a12b UTSW 4 115433503 missense possibly damaging 0.87
R2109:Cyp4a12b UTSW 4 115432913 missense probably damaging 0.97
R2911:Cyp4a12b UTSW 4 115433526 nonsense probably null
R3791:Cyp4a12b UTSW 4 115434970 missense probably benign 0.01
R3815:Cyp4a12b UTSW 4 115432470 missense probably damaging 0.98
R3816:Cyp4a12b UTSW 4 115432470 missense probably damaging 0.98
R3817:Cyp4a12b UTSW 4 115432470 missense probably damaging 0.98
R3818:Cyp4a12b UTSW 4 115432470 missense probably damaging 0.98
R4586:Cyp4a12b UTSW 4 115432506 missense probably damaging 1.00
R5004:Cyp4a12b UTSW 4 115438113 missense probably benign 0.39
R5105:Cyp4a12b UTSW 4 115433761 missense probably damaging 1.00
R5354:Cyp4a12b UTSW 4 115433464 splice site probably null
R5655:Cyp4a12b UTSW 4 115433797 missense probably damaging 1.00
R5814:Cyp4a12b UTSW 4 115432497 missense probably damaging 0.97
R5952:Cyp4a12b UTSW 4 115414517 nonsense probably null
R6004:Cyp4a12b UTSW 4 115433467 missense probably benign 0.35
R6059:Cyp4a12b UTSW 4 115438104 missense possibly damaging 0.94
R6261:Cyp4a12b UTSW 4 115414543 nonsense probably null
R7484:Cyp4a12b UTSW 4 115432563 missense possibly damaging 0.81
R7734:Cyp4a12b UTSW 4 115411740 missense possibly damaging 0.89
RF045:Cyp4a12b UTSW 4 115432493 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TGGAAGCCTGAATGGGAAGCCATC -3'
(R):5'- AGAGGACCAAAGGACTTGGCTCTG -3'

Sequencing Primer
(F):5'- TGGGAAGCCATCTTCTAAAGAC -3'
(R):5'- TGGCTCTGCCTCAGAATTATG -3'
Posted On2014-01-29