Incidental Mutation 'R1226:Ptprh'
ID152229
Institutional Source Beutler Lab
Gene Symbol Ptprh
Ensembl Gene ENSMUSG00000035429
Gene Nameprotein tyrosine phosphatase, receptor type, H
SynonymsSAP-1
MMRRC Submission 039295-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1226 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location4548612-4604041 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 4603092 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 3 (R3*)
Ref Sequence ENSEMBL: ENSMUSP00000145543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049113] [ENSMUST00000166650] [ENSMUST00000206999]
Predicted Effect probably null
Transcript: ENSMUST00000049113
AA Change: R3*
SMART Domains Protein: ENSMUSP00000042396
Gene: ENSMUSG00000035429
AA Change: R3*

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FN3 67 145 2.42e-9 SMART
FN3 156 234 9.69e-9 SMART
FN3 245 323 1.57e-8 SMART
FN3 334 412 6.29e-8 SMART
FN3 427 505 7.75e-8 SMART
FN3 516 593 1.21e0 SMART
transmembrane domain 605 627 N/A INTRINSIC
PTPc 670 932 1.09e-132 SMART
Predicted Effect probably null
Transcript: ENSMUST00000166650
AA Change: R3*
SMART Domains Protein: ENSMUSP00000125833
Gene: ENSMUSG00000035429
AA Change: R3*

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FN3 67 145 2.42e-9 SMART
FN3 156 234 9.69e-9 SMART
FN3 245 323 1.57e-8 SMART
FN3 334 412 6.29e-8 SMART
FN3 427 505 7.75e-8 SMART
FN3 516 593 1.21e0 SMART
transmembrane domain 605 627 N/A INTRINSIC
PTPc 670 932 1.09e-132 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205341
Predicted Effect probably null
Transcript: ENSMUST00000206999
AA Change: R3*
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and a single intracytoplasmic catalytic domain, and thus represents a receptor-type PTP. The extracellular region contains eight fibronectin type III-like repeats and multiple N-glycosylation sites. The gene was shown to be expressed primarily in brain and liver, and at a lower level in heart and stomach. It was also found to be expressed in several cancer cell lines, but not in the corresponding normal tissues. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a null alllele exhibit normal intestinal epithelial cell morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Abcd2 G T 15: 91,191,043 A189E probably benign Het
Ahcy T C 2: 155,064,897 T159A probably benign Het
Arfgef2 T C 2: 166,827,640 V84A probably damaging Het
Brwd1 G A 16: 96,031,548 T1036M probably benign Het
Ccdc173 A G 2: 69,787,209 M76T possibly damaging Het
Ccdc187 G T 2: 26,276,121 S765R probably damaging Het
Chd1l G A 3: 97,562,625 R862* probably null Het
Crmp1 A G 5: 37,273,434 D71G probably damaging Het
Ctif CTGTGTCCGGTGT CTGT 18: 75,521,579 probably benign Het
Ctsb A C 14: 63,141,740 Y267S probably damaging Het
Cyp4a12b T A 4: 115,432,967 I239N possibly damaging Het
Dna2 T C 10: 62,960,424 V544A possibly damaging Het
Dnhd1 T A 7: 105,696,899 F2364Y probably damaging Het
Fsip2 A T 2: 82,981,011 E2558V probably damaging Het
Gm10061 A C 16: 89,151,281 Y48S unknown Het
Herc1 T A 9: 66,416,263 M1353K probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lin7a T C 10: 107,271,919 V20A probably benign Het
Lsr T A 7: 30,971,883 I142F probably damaging Het
Mei1 C T 15: 82,080,084 T275I possibly damaging Het
Mon2 A G 10: 123,002,819 V1593A probably benign Het
Mrpl32 A G 13: 14,611,511 I74T probably benign Het
Nek11 C T 9: 105,392,892 V44I probably damaging Het
Noa1 A G 5: 77,307,555 V438A possibly damaging Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr262 A C 19: 12,241,586 I25R probably benign Het
Olfr828 C T 9: 18,815,970 C108Y probably benign Het
Pcdhb17 T C 18: 37,487,260 L701P probably damaging Het
Pde11a G A 2: 76,158,354 S481L probably benign Het
Prkdc T C 16: 15,673,997 I602T possibly damaging Het
Reln A G 5: 21,910,866 L3048P probably damaging Het
Slc6a11 T A 6: 114,194,663 I265N possibly damaging Het
Sorbs2 T C 8: 45,795,619 S636P probably damaging Het
Supt5 T C 7: 28,328,747 I44V probably benign Het
Tdrd6 T A 17: 43,626,632 E1175V possibly damaging Het
Tnxb A C 17: 34,688,929 T1316P probably damaging Het
Ufc1 A C 1: 171,289,237 D119E probably benign Het
Vmn1r220 A G 13: 23,184,124 F134S probably damaging Het
Zfp106 A G 2: 120,524,079 S1404P probably damaging Het
Zfp866 A G 8: 69,766,290 F227L probably damaging Het
Zfyve28 A T 5: 34,217,064 H535Q probably benign Het
Other mutations in Ptprh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01766:Ptprh APN 7 4580916 missense probably benign 0.23
IGL02420:Ptprh APN 7 4580930 missense probably damaging 1.00
IGL02619:Ptprh APN 7 4549499 missense probably damaging 1.00
IGL02729:Ptprh APN 7 4580874 missense probably damaging 0.99
R0018:Ptprh UTSW 7 4601846 critical splice donor site probably null
R0049:Ptprh UTSW 7 4573362 missense possibly damaging 0.80
R0449:Ptprh UTSW 7 4598006 missense probably damaging 1.00
R0477:Ptprh UTSW 7 4597998 missense possibly damaging 0.87
R0626:Ptprh UTSW 7 4564272 missense probably benign 0.00
R0741:Ptprh UTSW 7 4554173 critical splice donor site probably null
R1068:Ptprh UTSW 7 4549463 missense possibly damaging 0.89
R1487:Ptprh UTSW 7 4552738 missense probably damaging 1.00
R1495:Ptprh UTSW 7 4580889 missense probably benign 0.02
R1537:Ptprh UTSW 7 4549699 missense probably damaging 1.00
R1601:Ptprh UTSW 7 4552638 missense probably damaging 1.00
R1731:Ptprh UTSW 7 4601913 missense probably benign 0.00
R1920:Ptprh UTSW 7 4549395 missense probably benign 0.25
R2082:Ptprh UTSW 7 4550775 missense probably damaging 1.00
R2180:Ptprh UTSW 7 4601868 missense probably benign 0.26
R2214:Ptprh UTSW 7 4552922 missense possibly damaging 0.78
R2245:Ptprh UTSW 7 4573346 missense probably benign 0.09
R2271:Ptprh UTSW 7 4603133 start gained probably benign
R3693:Ptprh UTSW 7 4554235 missense probably damaging 0.99
R3713:Ptprh UTSW 7 4571970 missense probably damaging 1.00
R4081:Ptprh UTSW 7 4580988 missense probably damaging 0.99
R4205:Ptprh UTSW 7 4597992 missense probably damaging 1.00
R4689:Ptprh UTSW 7 4597997 missense possibly damaging 0.74
R4782:Ptprh UTSW 7 4569577 missense probably benign 0.08
R4838:Ptprh UTSW 7 4573430 missense possibly damaging 0.78
R4974:Ptprh UTSW 7 4551007 splice site probably null
R5218:Ptprh UTSW 7 4597920 missense probably benign 0.05
R5430:Ptprh UTSW 7 4551047 missense probably damaging 1.00
R5533:Ptprh UTSW 7 4549505 missense probably damaging 1.00
R5544:Ptprh UTSW 7 4580910 nonsense probably null
R5547:Ptprh UTSW 7 4554222 nonsense probably null
R5869:Ptprh UTSW 7 4601940 missense probably benign 0.00
R5928:Ptprh UTSW 7 4573508 missense probably damaging 1.00
R6063:Ptprh UTSW 7 4573362 missense possibly damaging 0.80
R6112:Ptprh UTSW 7 4597923 missense probably benign 0.01
R6493:Ptprh UTSW 7 4580990 missense possibly damaging 0.65
R6733:Ptprh UTSW 7 4603044 splice site probably null
R6836:Ptprh UTSW 7 4551135 missense probably damaging 1.00
R6859:Ptprh UTSW 7 4549371 nonsense probably null
R6868:Ptprh UTSW 7 4601865 missense probably benign
R7015:Ptprh UTSW 7 4552627 critical splice donor site probably null
R7092:Ptprh UTSW 7 4580861 critical splice donor site probably null
R7147:Ptprh UTSW 7 4550782 missense probably damaging 1.00
R7177:Ptprh UTSW 7 4569481 missense possibly damaging 0.77
R7358:Ptprh UTSW 7 4551007 splice site probably null
R7436:Ptprh UTSW 7 4552743 missense probably damaging 1.00
R7512:Ptprh UTSW 7 4571781 missense possibly damaging 0.60
R7863:Ptprh UTSW 7 4603098 start codon destroyed probably benign 0.31
R7946:Ptprh UTSW 7 4603098 start codon destroyed probably benign 0.31
RF022:Ptprh UTSW 7 4549368 missense probably benign
Z1177:Ptprh UTSW 7 4597971 missense probably damaging 0.99
Z1177:Ptprh UTSW 7 4598118 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAGCCTGGTCCCATGTTTACTC -3'
(R):5'- TGTGCTGAGACTGAGGATTCCAGAC -3'

Sequencing Primer
(F):5'- GCTTGTCTATATTCCTCGAAATGCAG -3'
(R):5'- CTGAGGATTCCAGACTGGAC -3'
Posted On2014-01-29