Incidental Mutation 'R1226:Supt5'
ID152230
Institutional Source Beutler Lab
Gene Symbol Supt5
Ensembl Gene ENSMUSG00000003435
Gene Namesuppressor of Ty 5
SynonymsSupt5h, Spt5
MMRRC Submission 039295-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1226 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location28314891-28338746 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28328747 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 44 (I44V)
Ref Sequence ENSEMBL: ENSMUSP00000147059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003527] [ENSMUST00000207563] [ENSMUST00000208243] [ENSMUST00000209141]
Predicted Effect probably benign
Transcript: ENSMUST00000003527
AA Change: I192V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000003527
Gene: ENSMUSG00000003435
AA Change: I192V

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
coiled coil region 36 63 N/A INTRINSIC
Pfam:Spt5_N 73 170 8.1e-17 PFAM
NGN 174 265 2.2e-14 SMART
KOW 270 297 8.77e0 SMART
KOW 417 444 8.69e-4 SMART
KOW 469 496 9.1e-7 SMART
KOW 591 618 2.46e-3 SMART
low complexity region 677 695 N/A INTRINSIC
KOW 697 724 3.93e-2 SMART
CTD 766 902 2.09e-31 SMART
KOW 1028 1055 9.69e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207563
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207879
Predicted Effect probably benign
Transcript: ENSMUST00000208243
AA Change: I44V

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208367
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208726
Predicted Effect probably benign
Transcript: ENSMUST00000209141
AA Change: I192V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Abcd2 G T 15: 91,191,043 A189E probably benign Het
Ahcy T C 2: 155,064,897 T159A probably benign Het
Arfgef2 T C 2: 166,827,640 V84A probably damaging Het
Brwd1 G A 16: 96,031,548 T1036M probably benign Het
Ccdc173 A G 2: 69,787,209 M76T possibly damaging Het
Ccdc187 G T 2: 26,276,121 S765R probably damaging Het
Chd1l G A 3: 97,562,625 R862* probably null Het
Crmp1 A G 5: 37,273,434 D71G probably damaging Het
Ctif CTGTGTCCGGTGT CTGT 18: 75,521,579 probably benign Het
Ctsb A C 14: 63,141,740 Y267S probably damaging Het
Cyp4a12b T A 4: 115,432,967 I239N possibly damaging Het
Dna2 T C 10: 62,960,424 V544A possibly damaging Het
Dnhd1 T A 7: 105,696,899 F2364Y probably damaging Het
Fsip2 A T 2: 82,981,011 E2558V probably damaging Het
Gm10061 A C 16: 89,151,281 Y48S unknown Het
Herc1 T A 9: 66,416,263 M1353K probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lin7a T C 10: 107,271,919 V20A probably benign Het
Lsr T A 7: 30,971,883 I142F probably damaging Het
Mei1 C T 15: 82,080,084 T275I possibly damaging Het
Mon2 A G 10: 123,002,819 V1593A probably benign Het
Mrpl32 A G 13: 14,611,511 I74T probably benign Het
Nek11 C T 9: 105,392,892 V44I probably damaging Het
Noa1 A G 5: 77,307,555 V438A possibly damaging Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr262 A C 19: 12,241,586 I25R probably benign Het
Olfr828 C T 9: 18,815,970 C108Y probably benign Het
Pcdhb17 T C 18: 37,487,260 L701P probably damaging Het
Pde11a G A 2: 76,158,354 S481L probably benign Het
Prkdc T C 16: 15,673,997 I602T possibly damaging Het
Ptprh T A 7: 4,603,092 R3* probably null Het
Reln A G 5: 21,910,866 L3048P probably damaging Het
Slc6a11 T A 6: 114,194,663 I265N possibly damaging Het
Sorbs2 T C 8: 45,795,619 S636P probably damaging Het
Tdrd6 T A 17: 43,626,632 E1175V possibly damaging Het
Tnxb A C 17: 34,688,929 T1316P probably damaging Het
Ufc1 A C 1: 171,289,237 D119E probably benign Het
Vmn1r220 A G 13: 23,184,124 F134S probably damaging Het
Zfp106 A G 2: 120,524,079 S1404P probably damaging Het
Zfp866 A G 8: 69,766,290 F227L probably damaging Het
Zfyve28 A T 5: 34,217,064 H535Q probably benign Het
Other mutations in Supt5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Supt5 APN 7 28315382 missense probably benign 0.08
IGL01077:Supt5 APN 7 28323788 nonsense probably null
IGL01477:Supt5 APN 7 28317264 missense possibly damaging 0.94
IGL01813:Supt5 APN 7 28323975 missense probably damaging 0.99
IGL02405:Supt5 APN 7 28315824 missense probably benign 0.00
IGL02525:Supt5 APN 7 28318947 splice site probably benign
IGL02584:Supt5 APN 7 28326167 missense probably benign 0.08
IGL03387:Supt5 APN 7 28320083 missense possibly damaging 0.89
R0420:Supt5 UTSW 7 28317329 splice site probably benign
R0715:Supt5 UTSW 7 28329037 missense probably damaging 1.00
R1655:Supt5 UTSW 7 28330024 missense probably benign 0.00
R1801:Supt5 UTSW 7 28317214 critical splice donor site probably null
R2424:Supt5 UTSW 7 28315165 missense possibly damaging 0.47
R2883:Supt5 UTSW 7 28329320 missense possibly damaging 0.75
R4280:Supt5 UTSW 7 28317073 missense probably damaging 1.00
R4614:Supt5 UTSW 7 28325972 missense possibly damaging 0.65
R4792:Supt5 UTSW 7 28316329 missense probably benign 0.19
R4997:Supt5 UTSW 7 28316037 missense probably benign 0.05
R5041:Supt5 UTSW 7 28315380 missense probably damaging 1.00
R5062:Supt5 UTSW 7 28329015 splice site probably null
R5119:Supt5 UTSW 7 28316370 missense probably damaging 1.00
R5170:Supt5 UTSW 7 28316083 missense probably benign 0.05
R5687:Supt5 UTSW 7 28317763 missense probably benign 0.27
R5720:Supt5 UTSW 7 28322568 missense probably damaging 0.97
R5935:Supt5 UTSW 7 28329475 missense probably benign 0.09
R6032:Supt5 UTSW 7 28316175 missense probably damaging 1.00
R6032:Supt5 UTSW 7 28316175 missense probably damaging 1.00
R6049:Supt5 UTSW 7 28315197 missense probably benign 0.32
R7043:Supt5 UTSW 7 28320010 missense probably benign 0.00
R7085:Supt5 UTSW 7 28331489 missense unknown
R7152:Supt5 UTSW 7 28323900 missense probably benign 0.00
R7201:Supt5 UTSW 7 28316788 missense probably benign 0.03
R7401:Supt5 UTSW 7 28323772 missense probably damaging 0.99
Z1177:Supt5 UTSW 7 28317031 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GTCCAGTTCCCATCATCAGTCAGC -3'
(R):5'- TCCCATACGGGGTCAAGACACATAG -3'

Sequencing Primer
(F):5'- TCAGGCAGTGGTCTTCGC -3'
(R):5'- CAACCTGTGGACTGTCAAGTG -3'
Posted On2014-01-29