Incidental Mutation 'R1230:Vangl1'
ID152265
Institutional Source Beutler Lab
Gene Symbol Vangl1
Ensembl Gene ENSMUSG00000027860
Gene NameVANGL planar cell polarity 1
SynonymsmStbm, stbm, Lpp2, KITENIN
MMRRC Submission 039299-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.299) question?
Stock #R1230 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location102153583-102204693 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 102158293 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 509 (I509L)
Ref Sequence ENSEMBL: ENSMUSP00000029453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029453] [ENSMUST00000159388] [ENSMUST00000168312]
Predicted Effect probably benign
Transcript: ENSMUST00000029453
AA Change: I509L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000029453
Gene: ENSMUSG00000027860
AA Change: I509L

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Pfam:Strabismus 23 360 3.4e-171 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159388
SMART Domains Protein: ENSMUSP00000125043
Gene: ENSMUSG00000027860

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Pfam:Strabismus 25 526 8.6e-262 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160226
Predicted Effect unknown
Transcript: ENSMUST00000161021
AA Change: I235L
SMART Domains Protein: ENSMUSP00000125484
Gene: ENSMUSG00000027860
AA Change: I235L

DomainStartEndE-ValueType
Pfam:Strabismus 1 253 3.2e-118 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168312
AA Change: I459L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126254
Gene: ENSMUSG00000027860
AA Change: I459L

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Pfam:Strabismus 23 357 1.2e-170 PFAM
Pfam:Strabismus 354 476 9.5e-67 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tretraspanin family. The encoded protein may be involved in mediating intestinal trefoil factor induced wound healing in the intestinal mucosa. Mutations in this gene are associated with neural tube defects. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a gene trapped allele display abnormal orientation of cochlear hair cell stereociliary bundles but do not develop neural tube or cardiac outflow tract abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccdc88c A T 12: 100,948,488 Y496N probably benign Het
Cyp11b1 A G 15: 74,840,942 I90T probably benign Het
Cyp4f14 C A 17: 32,916,788 R33L probably benign Het
Dcc G A 18: 71,682,313 P330L probably damaging Het
Dgcr14 C T 16: 17,909,950 V122M probably benign Het
Dnm1 T C 2: 32,315,909 N64D probably damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Ecm1 A T 3: 95,735,426 probably null Het
Enam A G 5: 88,494,068 Y247C probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hrc A G 7: 45,336,463 D346G possibly damaging Het
Kdm5b T G 1: 134,613,254 C695G probably damaging Het
Lrig3 A G 10: 126,002,971 D449G probably damaging Het
Mrps31 C T 8: 22,419,743 P142S possibly damaging Het
Ppm1k T C 6: 57,525,074 T35A probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Vcpip1 A G 1: 9,725,224 V974A probably damaging Het
Xdh T C 17: 73,891,256 E1212G probably damaging Het
Zfp62 T C 11: 49,215,099 S6P probably damaging Het
Other mutations in Vangl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00640:Vangl1 APN 3 102158229 utr 3 prime probably benign
IGL00870:Vangl1 APN 3 102189440 missense probably damaging 1.00
IGL01533:Vangl1 APN 3 102163351 missense possibly damaging 0.88
IGL01981:Vangl1 APN 3 102184291 missense probably damaging 1.00
IGL02792:Vangl1 APN 3 102163423 missense probably damaging 0.98
IGL02800:Vangl1 APN 3 102163295 splice site probably benign
IGL02942:Vangl1 APN 3 102184031 missense probably damaging 1.00
IGL03029:Vangl1 APN 3 102184084 missense probably damaging 1.00
R0600:Vangl1 UTSW 3 102166937 missense probably damaging 1.00
R0904:Vangl1 UTSW 3 102183994 missense probably damaging 0.99
R1829:Vangl1 UTSW 3 102163466 missense probably benign
R2005:Vangl1 UTSW 3 102163466 missense probably benign
R2268:Vangl1 UTSW 3 102196844 missense probably damaging 1.00
R4181:Vangl1 UTSW 3 102165781 intron probably benign
R4662:Vangl1 UTSW 3 102166922 missense probably benign 0.00
R4724:Vangl1 UTSW 3 102184554 missense probably damaging 1.00
R4755:Vangl1 UTSW 3 102158292 missense probably benign 0.19
R5548:Vangl1 UTSW 3 102184446 missense possibly damaging 0.76
R5740:Vangl1 UTSW 3 102184134 missense probably damaging 0.99
R5758:Vangl1 UTSW 3 102184092 missense probably damaging 1.00
R6150:Vangl1 UTSW 3 102184519 missense probably damaging 1.00
R6373:Vangl1 UTSW 3 102158448 missense probably benign
R6943:Vangl1 UTSW 3 102165781 intron probably benign
R7474:Vangl1 UTSW 3 102184249 missense probably benign 0.22
R7616:Vangl1 UTSW 3 102184065 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGTCACAGAAACTCCAGGGAAC -3'
(R):5'- ACAAGGATCGATGGCTCTCGACAC -3'

Sequencing Primer
(F):5'- TCCAGGGAACAGCTTCTTCAG -3'
(R):5'- CTCTCGACACAGTGGAGACTTATTAG -3'
Posted On2014-01-29