Incidental Mutation 'R1231:Cmss1'
ID152305
Institutional Source Beutler Lab
Gene Symbol Cmss1
Ensembl Gene ENSMUSG00000022748
Gene Namecms small ribosomal subunit 1
Synonyms4930572F24Rik, 1110001A06Rik, 2610528E23Rik
MMRRC Submission 039300-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R1231 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location57302000-57606864 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 57316197 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 104 (R104H)
Ref Sequence ENSEMBL: ENSMUSP00000110011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114371]
Predicted Effect probably benign
Transcript: ENSMUST00000114371
AA Change: R104H

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000110011
Gene: ENSMUSG00000022748
AA Change: R104H

DomainStartEndE-ValueType
low complexity region 13 29 N/A INTRINSIC
Pfam:CMS1 42 266 7.9e-35 PFAM
Pfam:DEAD 127 234 4e-7 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc3 C T 10: 50,823,660 P1860S probably damaging Het
Cabp5 T C 7: 13,405,425 I125T probably damaging Het
Ccnd2 A T 6: 127,130,400 S269T probably benign Het
Dock9 A T 14: 121,575,950 M1522K possibly damaging Het
Fcrl5 A G 3: 87,442,179 H87R probably benign Het
Gabrr3 G A 16: 59,461,400 D373N probably benign Het
Gm21738 T A 14: 19,415,957 Y194F probably benign Het
Gm21738 T C 14: 19,415,963 K192R probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Itgae C T 11: 73,119,379 T565I probably benign Het
Mocos G T 18: 24,679,701 A551S probably benign Het
Mtmr9 A T 14: 63,528,191 N418K possibly damaging Het
Mtus2 T A 5: 148,077,388 S330R probably benign Het
Olfr31 A T 14: 14,328,515 M135L probably benign Het
Psg16 T A 7: 17,095,305 Y271* probably null Het
Psmd2 T A 16: 20,655,585 M297K possibly damaging Het
Rnf220 A T 4: 117,489,884 S110R probably damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
St8sia5 T C 18: 77,232,806 Y49H probably damaging Het
Umodl1 A G 17: 30,959,278 Y76C probably damaging Het
Urm1 G T 2: 29,832,699 A15S probably damaging Het
Other mutations in Cmss1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Cmss1 APN 16 57303729 missense probably damaging 0.99
R0031:Cmss1 UTSW 16 57311249 splice site probably null
R1556:Cmss1 UTSW 16 57316197 missense probably benign 0.14
R2017:Cmss1 UTSW 16 57316278 missense probably damaging 0.99
R3748:Cmss1 UTSW 16 57302272 missense probably damaging 0.96
R4835:Cmss1 UTSW 16 57316182 nonsense probably null
R5316:Cmss1 UTSW 16 57302275 missense probably damaging 0.99
R5598:Cmss1 UTSW 16 57311286 missense probably damaging 1.00
R5987:Cmss1 UTSW 16 57302245 missense probably benign 0.40
R7145:Cmss1 UTSW 16 57311355 missense probably benign 0.19
R7664:Cmss1 UTSW 16 57317947 missense probably benign 0.00
R8377:Cmss1 UTSW 16 57307394 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- CAAGGATTAAGAGTGTGTGCGTGGA -3'
(R):5'- CAGGGAGCCCGCTAGAGCA -3'

Sequencing Primer
(F):5'- CGTGGAAAAGGGATACATTTTCAAC -3'
(R):5'- AGCACTCACTATGTCATGAGG -3'
Posted On2014-01-29