Mutagenetix > Incidental Mutations

Incidental Mutation 'R1232:Arhgap29'

152316

Institutional Source

Beutler Lab

Gene Symbol

Arhgap29

Ensembl Gene

ENSMUSG00000039831

Gene Name

Rho GTPase activating protein 29

Synonyms

B130017I01Rik, 6720461J18Rik, C76601, Parg1

MMRRC Submission

039301-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1232 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

121952541-122016753 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 122003340 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 525 (D525G)

Ref Sequence

ENSEMBL: ENSMUSP00000142945 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037958] [ENSMUST00000197155]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000037958
AA Change: D525G

PolyPhen 2 Score 0.608 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000044624
Gene: ENSMUSG00000039831
AA Change: D525G

Domain	Start	End	E-Value	Type
low complexity region	5	12	N/A	INTRINSIC
PDB:3QWE\|A	193	469	5e-41	PDB
Blast:RhoGAP	412	595	9e-84	BLAST
C1	613	659	2.48e-6	SMART
RhoGAP	684	885	1.92e-68	SMART
low complexity region	947	961	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000197155
AA Change: D525G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000142945
Gene: ENSMUSG00000039831
AA Change: D525G

Domain	Start	End	E-Value	Type
low complexity region	5	12	N/A	INTRINSIC
PDB:3QWE\|A	193	469	8e-42	PDB
Blast:RhoGAP	412	595	2e-87	BLAST
C1	613	659	2.48e-6	SMART
RhoGAP	684	780	1.14e-6	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000198914
AA Change: D117G

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199550

Coding Region Coverage

1x: 99.1%
3x: 98.0%
10x: 95.0%
20x: 88.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rap1 is a small GTPase that, through effectors, regulates Rho GTPase signaling. These effectors- Rasip1, Radil, and the protein encoded by this gene- translocate to the cell membrane, where they form a multiprotein complex. This complex is necessary for Rap1-induced inhibition of Rho signaling. Defects in this gene may be a cause of nonsyndromic cleft lip with or without cleft palate. [provided by RefSeq, Jun 2016]

Allele List at MGI

Other mutations in this stock

Total: 20 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abl2	T	A	1: 156,641,730	L751M	probably damaging	Het
Ces2h	T	C	8: 105,014,655	M93T	probably benign	Het
Cyp4a12b	A	T	4: 115,432,563	D209V	possibly damaging	Het
Dync1h1	G	A	12: 110,636,509	E2195K	probably benign	Het
Fbxo38	A	G	18: 62,510,811	V925A	probably damaging	Het
Glp1r	A	C	17: 30,918,931	H112P	probably benign	Het
Gm8251	T	C	1: 44,056,592	Y1782C	possibly damaging	Het
Gtf3c5	A	G	2: 28,571,215	W296R	probably damaging	Het
Ints8	A	G	4: 11,234,587	I415T	possibly damaging	Het
Krt2	A	G	15: 101,811,784	S513P	probably damaging	Het
Loxhd1	G	A	18: 77,406,003		probably null	Het
Mfsd3	A	G	15: 76,703,182	Q355R	probably damaging	Het
Mms22l	C	T	4: 24,536,274	T621I	probably benign	Het
Olfr969	G	A	9: 39,795,968	V198I	probably benign	Het
Pcdhb8	A	G	18: 37,355,775	N169D	probably benign	Het
Rnls	T	G	19: 33,202,646	I135L	probably benign	Het
Sgsm1	G	T	5: 113,273,711	C558*	probably null	Het
Spata31d1c	T	A	13: 65,036,614	C657S	probably benign	Het
Vmn2r15	T	C	5: 109,293,302	D230G	probably benign	Het
Zfp429	T	C	13: 67,390,632	Y231C	possibly damaging	Het

Other mutations in Arhgap29

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00492:Arhgap29	APN	3	122003312	nonsense	probably null
IGL01121:Arhgap29	APN	3	122009863	missense	probably damaging	1.00
IGL01622:Arhgap29	APN	3	121974124	splice site	probably benign
IGL01623:Arhgap29	APN	3	121974124	splice site	probably benign
IGL01995:Arhgap29	APN	3	122014328	missense	probably benign	0.00
IGL02120:Arhgap29	APN	3	122004257	missense	probably benign	0.05
IGL02554:Arhgap29	APN	3	121992524	unclassified	probably benign
IGL02931:Arhgap29	APN	3	121992860	missense	probably benign
IGL02937:Arhgap29	APN	3	121974049	missense	probably damaging	0.99
PIT4362001:Arhgap29	UTSW	3	122003212	missense	probably benign	0.42
R0022:Arhgap29	UTSW	3	121988937	missense	possibly damaging	0.61
R0574:Arhgap29	UTSW	3	122007625	missense	probably benign	0.01
R0601:Arhgap29	UTSW	3	121991110	missense	probably damaging	1.00
R0639:Arhgap29	UTSW	3	122007641	missense	probably damaging	1.00
R0881:Arhgap29	UTSW	3	122014679	missense	probably damaging	1.00
R1295:Arhgap29	UTSW	3	121992395	missense	probably benign	0.27
R1296:Arhgap29	UTSW	3	121992395	missense	probably benign	0.27
R1403:Arhgap29	UTSW	3	121973929	missense	probably damaging	1.00
R1403:Arhgap29	UTSW	3	121973929	missense	probably damaging	1.00
R1470:Arhgap29	UTSW	3	121992319	unclassified	probably benign
R1710:Arhgap29	UTSW	3	122008080	missense	probably damaging	1.00
R1878:Arhgap29	UTSW	3	122011371	missense	probably damaging	1.00
R2051:Arhgap29	UTSW	3	121981860	missense	probably benign	0.01
R2112:Arhgap29	UTSW	3	122011561	missense	probably benign	0.03
R2188:Arhgap29	UTSW	3	121991009	missense	probably damaging	1.00
R2240:Arhgap29	UTSW	3	122011453	missense	probably benign	0.12
R2420:Arhgap29	UTSW	3	121973980	missense	probably benign
R3618:Arhgap29	UTSW	3	121988527	missense	possibly damaging	0.62
R4673:Arhgap29	UTSW	3	122014971	missense	probably damaging	1.00
R4717:Arhgap29	UTSW	3	122009958	missense	possibly damaging	0.82
R5028:Arhgap29	UTSW	3	122010060	critical splice donor site	probably null
R5043:Arhgap29	UTSW	3	121974004	missense	probably benign	0.00
R5045:Arhgap29	UTSW	3	122002595	missense	probably benign	0.28
R5463:Arhgap29	UTSW	3	121988551	missense	possibly damaging	0.94
R5495:Arhgap29	UTSW	3	122014929	missense	probably damaging	1.00
R5743:Arhgap29	UTSW	3	121981911	missense	probably damaging	1.00
R5791:Arhgap29	UTSW	3	122014245	missense	probably damaging	0.98
R5896:Arhgap29	UTSW	3	122012087	missense	possibly damaging	0.78
R6083:Arhgap29	UTSW	3	121992748	missense	probably benign	0.00
R6355:Arhgap29	UTSW	3	122011258	missense	possibly damaging	0.46
R6451:Arhgap29	UTSW	3	121993581	missense	probably damaging	1.00
R6528:Arhgap29	UTSW	3	122014702	missense	probably benign	0.13
R7239:Arhgap29	UTSW	3	121988950	missense	probably benign	0.16
R7669:Arhgap29	UTSW	3	121992812	missense	probably damaging	1.00
R7807:Arhgap29	UTSW	3	122014332	missense	probably benign	0.01
R8045:Arhgap29	UTSW	3	122007562	synonymous	silent
R8048:Arhgap29	UTSW	3	121992901	missense	probably damaging	1.00
R8165:Arhgap29	UTSW	3	121988573	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AGGATGATGCTTTCTATTTTCACACGCT -3'
(R):5'- CCTTGCCTACAGGTAGATTTCATAGGGT -3'

Sequencing Primer
(F):5'- CTCTTTGGAAGTAGCAAATGATAACC -3'
(R):5'- GGTAGATTTCATAGGGTGAAATACTG -3'

Posted On

2014-01-29