Incidental Mutation 'R1232:Zfp429'
ID152328
Institutional Source Beutler Lab
Gene Symbol Zfp429
Ensembl Gene ENSMUSG00000078994
Gene Namezinc finger protein 429
Synonyms2810487A22Rik
MMRRC Submission 039301-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R1232 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location67387905-67399819 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67390632 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 231 (Y231C)
Ref Sequence ENSEMBL: ENSMUSP00000105354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109732] [ENSMUST00000181071] [ENSMUST00000224684] [ENSMUST00000224825]
Predicted Effect possibly damaging
Transcript: ENSMUST00000109732
AA Change: Y231C

PolyPhen 2 Score 0.467 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105354
Gene: ENSMUSG00000078994
AA Change: Y231C

DomainStartEndE-ValueType
KRAB 15 75 7.16e-34 SMART
ZnF_C2H2 119 141 5.12e1 SMART
ZnF_C2H2 147 169 2.27e-4 SMART
ZnF_C2H2 175 197 1.28e-3 SMART
ZnF_C2H2 203 225 1.56e-2 SMART
ZnF_C2H2 259 281 4.62e1 SMART
ZnF_C2H2 287 309 5.14e-3 SMART
ZnF_C2H2 315 337 6.78e-3 SMART
ZnF_C2H2 343 365 3.11e-2 SMART
ZnF_C2H2 371 393 1.25e-1 SMART
ZnF_C2H2 399 421 6.32e-3 SMART
ZnF_C2H2 427 449 1.47e-3 SMART
ZnF_C2H2 455 477 5.42e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000181071
SMART Domains Protein: ENSMUSP00000137755
Gene: ENSMUSG00000078994

DomainStartEndE-ValueType
KRAB 15 75 7.16e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000224684
Predicted Effect probably benign
Transcript: ENSMUST00000224825
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225810
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 88.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl2 T A 1: 156,641,730 L751M probably damaging Het
Arhgap29 A G 3: 122,003,340 D525G probably damaging Het
Ces2h T C 8: 105,014,655 M93T probably benign Het
Cyp4a12b A T 4: 115,432,563 D209V possibly damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Fbxo38 A G 18: 62,510,811 V925A probably damaging Het
Glp1r A C 17: 30,918,931 H112P probably benign Het
Gm8251 T C 1: 44,056,592 Y1782C possibly damaging Het
Gtf3c5 A G 2: 28,571,215 W296R probably damaging Het
Ints8 A G 4: 11,234,587 I415T possibly damaging Het
Krt2 A G 15: 101,811,784 S513P probably damaging Het
Loxhd1 G A 18: 77,406,003 probably null Het
Mfsd3 A G 15: 76,703,182 Q355R probably damaging Het
Mms22l C T 4: 24,536,274 T621I probably benign Het
Olfr969 G A 9: 39,795,968 V198I probably benign Het
Pcdhb8 A G 18: 37,355,775 N169D probably benign Het
Rnls T G 19: 33,202,646 I135L probably benign Het
Sgsm1 G T 5: 113,273,711 C558* probably null Het
Spata31d1c T A 13: 65,036,614 C657S probably benign Het
Vmn2r15 T C 5: 109,293,302 D230G probably benign Het
Other mutations in Zfp429
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Zfp429 APN 13 67391013 missense probably damaging 0.96
IGL01913:Zfp429 APN 13 67396674 missense probably damaging 1.00
IGL02343:Zfp429 APN 13 67390725 missense probably damaging 0.98
IGL02679:Zfp429 APN 13 67399736 intron probably benign
IGL03396:Zfp429 APN 13 67396040 splice site probably benign
FR4342:Zfp429 UTSW 13 67396650 missense probably benign 0.02
R0012:Zfp429 UTSW 13 67390677 missense probably benign 0.01
R1330:Zfp429 UTSW 13 67396143 splice site probably null
R1653:Zfp429 UTSW 13 67389924 missense possibly damaging 0.87
R1761:Zfp429 UTSW 13 67396076 missense probably benign 0.28
R1813:Zfp429 UTSW 13 67390386 missense possibly damaging 0.55
R2356:Zfp429 UTSW 13 67390627 missense probably benign
R4280:Zfp429 UTSW 13 67390795 missense probably damaging 1.00
R4283:Zfp429 UTSW 13 67390795 missense probably damaging 1.00
R4464:Zfp429 UTSW 13 67390498 missense probably benign 0.13
R4789:Zfp429 UTSW 13 67390404 missense probably benign 0.06
R5187:Zfp429 UTSW 13 67390840 missense probably damaging 0.99
R5250:Zfp429 UTSW 13 67390519 missense probably benign 0.00
R6688:Zfp429 UTSW 13 67396130 missense probably damaging 0.98
R6772:Zfp429 UTSW 13 67390198 missense probably damaging 1.00
R6989:Zfp429 UTSW 13 67389961 missense probably benign 0.00
R7041:Zfp429 UTSW 13 67390711 missense probably damaging 1.00
R7101:Zfp429 UTSW 13 67390812 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GTCTTCACACTTGTAGGGTTTGTCTTCA -3'
(R):5'- GGCCTTCAGTACTCGCTCATCAC -3'

Sequencing Primer
(F):5'- aaggcaggaagatgaggaatag -3'
(R):5'- AGTACTCGCTCATCACTTTTTATAC -3'
Posted On2014-01-29