Incidental Mutation 'R1232:Mfsd3'
ID152329
Institutional Source Beutler Lab
Gene Symbol Mfsd3
Ensembl Gene ENSMUSG00000019080
Gene Namemajor facilitator superfamily domain containing 3
Synonyms
MMRRC Submission 039301-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R1232 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location76701465-76704239 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76703182 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 355 (Q355R)
Ref Sequence ENSEMBL: ENSMUSP00000019224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019224] [ENSMUST00000023203] [ENSMUST00000036852] [ENSMUST00000229140] [ENSMUST00000229679] [ENSMUST00000229734] [ENSMUST00000230544] [ENSMUST00000230724]
Predicted Effect probably damaging
Transcript: ENSMUST00000019224
AA Change: Q355R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019224
Gene: ENSMUSG00000019080
AA Change: Q355R

DomainStartEndE-ValueType
Pfam:MFS_1 8 373 3e-16 PFAM
transmembrane domain 388 407 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000023203
SMART Domains Protein: ENSMUSP00000023203
Gene: ENSMUSG00000022546

DomainStartEndE-ValueType
Pfam:Aminotran_1_2 83 484 7.8e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000036852
SMART Domains Protein: ENSMUSP00000044363
Gene: ENSMUSG00000033762

DomainStartEndE-ValueType
Pfam:Drc1-Sld2 4 132 2.8e-14 PFAM
low complexity region 169 187 N/A INTRINSIC
low complexity region 368 379 N/A INTRINSIC
ZnF_C2HC 394 410 5.67e-5 SMART
DEXDc 494 701 5.86e-28 SMART
HELICc 736 831 1.48e-24 SMART
Blast:DEXDc 902 1117 3e-46 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228987
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229018
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229098
Predicted Effect probably benign
Transcript: ENSMUST00000229140
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229340
Predicted Effect probably benign
Transcript: ENSMUST00000229679
Predicted Effect probably benign
Transcript: ENSMUST00000229734
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229856
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230283
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230468
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230482
Predicted Effect probably benign
Transcript: ENSMUST00000230544
Predicted Effect probably benign
Transcript: ENSMUST00000230724
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 88.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl2 T A 1: 156,641,730 L751M probably damaging Het
Arhgap29 A G 3: 122,003,340 D525G probably damaging Het
Ces2h T C 8: 105,014,655 M93T probably benign Het
Cyp4a12b A T 4: 115,432,563 D209V possibly damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Fbxo38 A G 18: 62,510,811 V925A probably damaging Het
Glp1r A C 17: 30,918,931 H112P probably benign Het
Gm8251 T C 1: 44,056,592 Y1782C possibly damaging Het
Gtf3c5 A G 2: 28,571,215 W296R probably damaging Het
Ints8 A G 4: 11,234,587 I415T possibly damaging Het
Krt2 A G 15: 101,811,784 S513P probably damaging Het
Loxhd1 G A 18: 77,406,003 probably null Het
Mms22l C T 4: 24,536,274 T621I probably benign Het
Olfr969 G A 9: 39,795,968 V198I probably benign Het
Pcdhb8 A G 18: 37,355,775 N169D probably benign Het
Rnls T G 19: 33,202,646 I135L probably benign Het
Sgsm1 G T 5: 113,273,711 C558* probably null Het
Spata31d1c T A 13: 65,036,614 C657S probably benign Het
Vmn2r15 T C 5: 109,293,302 D230G probably benign Het
Zfp429 T C 13: 67,390,632 Y231C possibly damaging Het
Other mutations in Mfsd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02965:Mfsd3 APN 15 76703152 missense probably benign 0.01
IGL03159:Mfsd3 APN 15 76702901 missense probably benign
R1389:Mfsd3 UTSW 15 76702689 missense probably benign 0.01
R1535:Mfsd3 UTSW 15 76702779 missense probably damaging 1.00
R4159:Mfsd3 UTSW 15 76701745 missense probably damaging 1.00
R4993:Mfsd3 UTSW 15 76701982 missense probably damaging 1.00
R5307:Mfsd3 UTSW 15 76702171 nonsense probably null
R6902:Mfsd3 UTSW 15 76703149 missense probably damaging 1.00
R6946:Mfsd3 UTSW 15 76703149 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACTGAAGCTGTTGAAGACAGTGC -3'
(R):5'- CAACATCCAGCTCAGGTCAGGTTAC -3'

Sequencing Primer
(F):5'- ACCCTGGCACAGTCATGAG -3'
(R):5'- CCAGGCGGAGATCCAGAAC -3'
Posted On2014-01-29