Incidental Mutation 'R1232:Krt1c'
ID 152330
Institutional Source Beutler Lab
Gene Symbol Krt1c
Ensembl Gene
Gene Name keratin 1 complex
Synonyms Krt-2, Krt2
MMRRC Submission 039301-MU
Accession Numbers
Essential gene? Not available question?
Stock # R1232 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 101720219 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 513 (S513P)
Ref Sequence ENSEMBL: ENSMUSP00000023712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023712]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000023712
AA Change: S513P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023712
Gene: ENSMUSG00000064201
AA Change: S513P

DomainStartEndE-ValueType
Pfam:Keratin_2_head 23 195 3.6e-26 PFAM
Filament 198 511 4.22e-152 SMART
low complexity region 520 533 N/A INTRINSIC
low complexity region 538 701 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 88.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl2 T A 1: 156,469,300 (GRCm39) L751M probably damaging Het
Arhgap29 A G 3: 121,796,989 (GRCm39) D525G probably damaging Het
Ccdc168 T C 1: 44,095,752 (GRCm39) Y1782C possibly damaging Het
Ces2h T C 8: 105,741,287 (GRCm39) M93T probably benign Het
Cyp4a12b A T 4: 115,289,760 (GRCm39) D209V possibly damaging Het
Dync1h1 G A 12: 110,602,943 (GRCm39) E2195K probably benign Het
Fbxo38 A G 18: 62,643,882 (GRCm39) V925A probably damaging Het
Glp1r A C 17: 31,137,905 (GRCm39) H112P probably benign Het
Gtf3c5 A G 2: 28,461,227 (GRCm39) W296R probably damaging Het
Ints8 A G 4: 11,234,587 (GRCm39) I415T possibly damaging Het
Loxhd1 G A 18: 77,493,699 (GRCm39) probably null Het
Mfsd3 A G 15: 76,587,382 (GRCm39) Q355R probably damaging Het
Mms22l C T 4: 24,536,274 (GRCm39) T621I probably benign Het
Or8g54 G A 9: 39,707,264 (GRCm39) V198I probably benign Het
Pcdhb8 A G 18: 37,488,828 (GRCm39) N169D probably benign Het
Rnls T G 19: 33,180,046 (GRCm39) I135L probably benign Het
Sgsm1 G T 5: 113,421,577 (GRCm39) C558* probably null Het
Spata31d1c T A 13: 65,184,428 (GRCm39) C657S probably benign Het
Vmn2r15 T C 5: 109,441,168 (GRCm39) D230G probably benign Het
Zfp429 T C 13: 67,538,751 (GRCm39) Y231C possibly damaging Het
Other mutations in Krt1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01316:Krt1c APN 15 101,719,646 (GRCm39) missense probably benign 0.23
IGL01568:Krt1c APN 15 101,721,646 (GRCm39) missense probably damaging 1.00
IGL01586:Krt1c APN 15 101,719,825 (GRCm39) missense unknown
IGL01667:Krt1c APN 15 101,724,765 (GRCm39) missense possibly damaging 0.85
IGL02017:Krt1c APN 15 101,724,939 (GRCm39) missense probably damaging 1.00
IGL02022:Krt1c APN 15 101,724,953 (GRCm39) missense probably damaging 1.00
IGL02538:Krt1c APN 15 101,719,589 (GRCm39) missense unknown
IGL02959:Krt1c APN 15 101,719,763 (GRCm39) missense unknown
IGL03295:Krt1c APN 15 101,724,864 (GRCm39) missense probably damaging 0.99
R0195:Krt1c UTSW 15 101,721,626 (GRCm39) nonsense probably null
R0472:Krt1c UTSW 15 101,721,688 (GRCm39) missense probably damaging 1.00
R0749:Krt1c UTSW 15 101,726,098 (GRCm39) missense unknown
R0785:Krt1c UTSW 15 101,726,356 (GRCm39) missense unknown
R0792:Krt1c UTSW 15 101,724,932 (GRCm39) missense probably damaging 1.00
R1281:Krt1c UTSW 15 101,721,727 (GRCm39) missense probably damaging 1.00
R1770:Krt1c UTSW 15 101,719,589 (GRCm39) missense unknown
R1783:Krt1c UTSW 15 101,722,408 (GRCm39) missense probably damaging 1.00
R1795:Krt1c UTSW 15 101,724,861 (GRCm39) missense possibly damaging 0.85
R2283:Krt1c UTSW 15 101,722,822 (GRCm39) missense probably damaging 1.00
R3977:Krt1c UTSW 15 101,719,562 (GRCm39) missense unknown
R4575:Krt1c UTSW 15 101,722,921 (GRCm39) missense probably damaging 1.00
R4619:Krt1c UTSW 15 101,726,026 (GRCm39) missense probably damaging 1.00
R4620:Krt1c UTSW 15 101,726,026 (GRCm39) missense probably damaging 1.00
R4766:Krt1c UTSW 15 101,722,395 (GRCm39) missense probably damaging 1.00
R4819:Krt1c UTSW 15 101,719,979 (GRCm39) missense unknown
R4953:Krt1c UTSW 15 101,722,377 (GRCm39) missense probably damaging 1.00
R5108:Krt1c UTSW 15 101,721,721 (GRCm39) missense possibly damaging 0.88
R5973:Krt1c UTSW 15 101,724,747 (GRCm39) missense probably damaging 0.99
R6122:Krt1c UTSW 15 101,724,349 (GRCm39) missense probably damaging 1.00
R6180:Krt1c UTSW 15 101,723,479 (GRCm39) missense probably benign 0.05
R6661:Krt1c UTSW 15 101,724,398 (GRCm39) missense probably damaging 1.00
R6974:Krt1c UTSW 15 101,726,314 (GRCm39) missense unknown
R6993:Krt1c UTSW 15 101,724,395 (GRCm39) missense probably damaging 1.00
R7104:Krt1c UTSW 15 101,723,522 (GRCm39) missense probably benign 0.09
R7573:Krt1c UTSW 15 101,722,954 (GRCm39) missense probably benign 0.05
R7947:Krt1c UTSW 15 101,724,769 (GRCm39) missense probably damaging 1.00
R8469:Krt1c UTSW 15 101,724,804 (GRCm39) missense probably benign 0.22
R8805:Krt1c UTSW 15 101,724,379 (GRCm39) missense possibly damaging 0.93
R9051:Krt1c UTSW 15 101,726,317 (GRCm39) missense unknown
R9118:Krt1c UTSW 15 101,722,976 (GRCm39) missense probably damaging 0.99
R9230:Krt1c UTSW 15 101,725,948 (GRCm39) missense probably benign 0.39
R9257:Krt1c UTSW 15 101,724,926 (GRCm39) missense probably benign 0.05
R9424:Krt1c UTSW 15 101,719,792 (GRCm39) missense unknown
R9569:Krt1c UTSW 15 101,724,924 (GRCm39) missense probably damaging 1.00
R9576:Krt1c UTSW 15 101,719,792 (GRCm39) missense unknown
RF020:Krt1c UTSW 15 101,726,403 (GRCm39) missense unknown
Z1177:Krt1c UTSW 15 101,719,985 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CGAAGCCAGTCTTAGATGCCACAG -3'
(R):5'- CTCTGCATAGCAGATTCCCTGAGC -3'

Sequencing Primer
(F):5'- CCAGTCTTAGATGCCACAGATGAG -3'
(R):5'- CCTCAGGATGGACTGAGATTC -3'
Posted On 2014-01-29