Incidental Mutation 'R1233:Rem1'
ID152339
Institutional Source Beutler Lab
Gene Symbol Rem1
Ensembl Gene ENSMUSG00000000359
Gene Namerad and gem related GTP binding protein 1
SynonymsE030011C07Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R1233 (G1)
Quality Score129
Status Not validated
Chromosome2
Chromosomal Location152626951-152635198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 152634535 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 238 (V238M)
Ref Sequence ENSEMBL: ENSMUSP00000000369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000369]
Predicted Effect probably damaging
Transcript: ENSMUST00000000369
AA Change: V238M

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000000369
Gene: ENSMUSG00000000359
AA Change: V238M

DomainStartEndE-ValueType
low complexity region 64 77 N/A INTRINSIC
Pfam:Roc 82 198 1e-10 PFAM
Pfam:Ras 82 244 2.6e-32 PFAM
low complexity region 258 290 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139370
Meta Mutation Damage Score 0.2146 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 95.9%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a GTPase and member of the RAS-like GTP-binding protein family. The encoded protein is expressed in endothelial cells, where it promotes reorganization of the actin cytoskeleton and morphological changes in the cells. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T A 13: 63,199,520 M631K probably damaging Het
Ache A G 5: 137,290,157 probably null Het
Arfgef1 T C 1: 10,184,090 D773G probably damaging Het
Arhgap45 T C 10: 80,027,582 I753T probably damaging Het
Cd274 T A 19: 29,373,901 probably null Het
Cdh16 C T 8: 104,618,482 A392T possibly damaging Het
Csmd3 T C 15: 48,673,531 T92A probably damaging Het
Exosc8 A T 3: 54,731,998 C129S probably benign Het
Fat3 T G 9: 15,922,745 I4184L probably benign Het
Frem2 A G 3: 53,547,778 Y2126H probably damaging Het
Fsbp T C 4: 11,580,053 M107T possibly damaging Het
Gper1 A G 5: 139,426,602 Y234C probably damaging Het
Hmcn1 T C 1: 150,749,026 S1043G probably benign Het
Kif2a T A 13: 106,987,332 K137N probably damaging Het
Mrc2 T C 11: 105,348,415 F1332S probably damaging Het
Nme8 T A 13: 19,660,512 M375L possibly damaging Het
Olfr392 T A 11: 73,814,350 H244L probably damaging Het
Per1 T C 11: 69,102,211 L298P probably damaging Het
Polr2b A G 5: 77,334,565 N650S probably benign Het
Ppara T C 15: 85,798,021 V306A probably damaging Het
Repin1 A G 6: 48,597,834 T566A possibly damaging Het
Rhot2 T A 17: 25,844,097 D57V probably damaging Het
Samd4b C T 7: 28,414,010 G177R probably damaging Het
Slc5a8 C A 10: 88,918,442 P435H probably damaging Het
Stpg1 G A 4: 135,525,429 A164T probably benign Het
Tll2 G T 19: 41,095,984 A668D possibly damaging Het
Txnl1 T A 18: 63,675,468 M180L probably benign Het
Vopp1 A C 6: 57,789,995 L32R probably damaging Het
Wdr95 C T 5: 149,581,858 T226I possibly damaging Het
Wdr95 C A 5: 149,595,364 Q557K probably benign Het
Other mutations in Rem1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1121:Rem1 UTSW 2 152634535 missense probably damaging 0.96
R1122:Rem1 UTSW 2 152634535 missense probably damaging 0.96
R1126:Rem1 UTSW 2 152634535 missense probably damaging 0.96
R1235:Rem1 UTSW 2 152634535 missense probably damaging 0.96
R1378:Rem1 UTSW 2 152634535 missense probably damaging 0.96
R1709:Rem1 UTSW 2 152634535 missense probably damaging 0.96
R1713:Rem1 UTSW 2 152634535 missense probably damaging 0.96
R1911:Rem1 UTSW 2 152634535 missense probably damaging 0.96
R1912:Rem1 UTSW 2 152634535 missense probably damaging 0.96
R5442:Rem1 UTSW 2 152628057 critical splice acceptor site probably null
R5853:Rem1 UTSW 2 152628280 missense possibly damaging 0.92
R6062:Rem1 UTSW 2 152628097 start codon destroyed probably null 1.00
R6072:Rem1 UTSW 2 152634517 missense probably benign
R7215:Rem1 UTSW 2 152628149 missense probably damaging 1.00
R7635:Rem1 UTSW 2 152634665 missense probably damaging 1.00
X0057:Rem1 UTSW 2 152629191 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- TGCTTCCTGAGAGTTTGAACACA -3'
(R):5'- CTTTTCTCCTCAGTGGCACCATA -3'

Sequencing Primer
(F):5'- CATCTCTTCCCACCTTTATC -3'
(R):5'- ATAGTGTCCCATCACCCCAG -3'
Posted On2014-01-29